Human TMED2/p24/P24A ORF/cDNA clone-Lentivirus plasmid (NM_006815)

Cat. No.: pGMLP003256
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human TMED2/p24/P24A Lentiviral expression plasmid for TMED2 lentivirus packaging, TMED2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to TMED2/p24 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $451.5
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP003256
Gene Name TMED2
Accession Number NM_006815
Gene ID 10959
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 606 bp
Gene Alias p24,P24A,p24b1,p24beta1,RNP24
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGTGACGCTTGCTGAACTGCTGGTGCTTCTGGCCGCTCTCCTGGCCACGGTCTCGGGCTATTTCGTTAGCATCGACGCCCATGCTGAAGAGTGCTTCTTTGAGCGGGTCACCTCGGGCACCAAGATGGGCCTCATCTTCGAGGTGGCGGAGGGCGGCTTCCTGGACATCGACGTGGAGATTACAGGACCAGATAACAAAGGAATTTACAAAGGAGACAGAGAATCCAGTGGGAAATACACATTTGCTGCTCACATGGATGGAACATACAAATTTTGTTTTAGTAACCGGATGTCCACCATGACTCCAAAAATAGTGATGTTCACCATTGATATTGGGGAGGCTCCAAAAGGACAAGATATGGAAACAGAAGCTCACCAGAACAAGCTAGAAGAAATGATCAATGAGCTAGCAGTGGCGATGACAGCTGTAAAGCACGAACAGGAATACATGGAAGTCCGGGAGAGAATACACAGAGCCATCAACGACAACACAAACAGCAGAGTGGTCCTTTGGTCCTTCTTTGAAGCTCTTGTTCTAGTTGCCATGACATTGGGACAGATCTACTACCTGAAGAGATTTTTTGAAGTCCGGAGAGTTGTTTAA
ORF Protein Sequence MVTLAELLVLLAALLATVSGYFVSIDAHAEECFFERVTSGTKMGLIFEVAEGGFLDIDVEITGPDNKGIYKGDRESSGKYTFAAHMDGTYKFCFSNRMSTMTPKIVMFTIDIGEAPKGQDMETEAHQNKLEEMINELAVAMTAVKHEQEYMEVRERIHRAINDNTNSRVVLWSFFEALVLVAMTLGQIYYLKRFFEVRRVV

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP1947-Ab Anti-TMED2 monoclonal antibody
    Target Antigen GM-Tg-g-IP1947-Ag TMED2 protein
    ORF Viral Vector pGMLP003256 Human TMED2 Lentivirus plasmid
    ORF Viral Vector vGMLP003256 Human TMED2 Lentivirus particle


    Target information

    Target ID GM-IP1947
    Target Name TMED2
    Gene ID 10959, 56334, 106992483, 65165, 101100419, 100687986, 100140040, 100061043
    Gene Symbol and Synonyms 1110032D12Rik,1810020N21Rik,p24,P24A,p24b1,p24beta1,RNP24,Sid394,TMED2
    Uniprot Accession Q15363
    Uniprot Entry Name TMED2_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000086598
    Target Classification Not Available

    Involved in several processes, including Golgi organization; negative regulation of GTPase activity; and protein localization to plasma membrane. Located in Golgi apparatus; endoplasmic reticulum; and endoplasmic reticulum-Golgi intermediate compartment. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.