Human VKORC1L1 ORF/cDNA clone-Lentivirus plasmid (NM_173517)

Cat. No.: pGMLP003261
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human VKORC1L1/ Lentiviral expression plasmid for VKORC1L1 lentivirus packaging, VKORC1L1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to VKORC1L1/ products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $432.75
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP003261
Gene Name VKORC1L1
Accession Number NM_173517
Gene ID 154807
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 531 bp
Gene Alias
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCGGCTCCCGTCCTGCTAAGAGTGTCGGTGCCGCGGTGGGAGCGGGTGGCCCGGTATGCAGTGTGCGCTGCCGGAATCCTGCTCTCCATCTACGCCTACCACGTGGAGCGGGAGAAGGAGCGGGACCCCGAGCACCGGGCCCTCTGCGACCTGGGGCCCTGGGTGAAGTGCTCCGCCGCCCTTGCCTCCAGATGGGGTCGAGGATTTGGTCTTTTGGGTTCCATTTTTGGAAAGGATGGTGTATTAAACCAGCCAAACAGTGTCTTTGGACTTATATTTTATATACTACAGTTATTACTTGGCATGACAGCAAGCGCTGTGGCGGCTTTGATCCTCATGACGTCCTCCATCATGTCGGTCGTGGGGTCCCTGTACCTGGCCTACATTCTGTACTTTGTGCTGAAGGAGTTCTGCATCATCTGCATCGTCACGTACGTGCTGAACTTCCTTCTTCTCATTATCAACTACAAACGACTAGTTTACTTGAACGAGGCCTGGAAGCGGCAGCTGCAACCCAAGCAGGACTGA
ORF Protein Sequence MAAPVLLRVSVPRWERVARYAVCAAGILLSIYAYHVEREKERDPEHRALCDLGPWVKCSAALASRWGRGFGLLGSIFGKDGVLNQPNSVFGLIFYILQLLLGMTASAVAALILMTSSIMSVVGSLYLAYILYFVLKEFCIICIVTYVLNFLLLIINYKRLVYLNEAWKRQLQPKQD

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP2258-Ab Anti-VKORC1L1 monoclonal antibody
    Target Antigen GM-Tg-g-IP2258-Ag VKORC1L1 protein
    ORF Viral Vector pGMLP003261 Human VKORC1L1 Lentivirus plasmid
    ORF Viral Vector vGMLP003261 Human VKORC1L1 Lentivirus particle


    Target information

    Target ID GM-IP2258
    Target Name VKORC1L1
    Gene ID 154807, 69568, 697591, 399684, 101085010, 606915, 506318, 100629446
    Gene Symbol and Synonyms 2310024K08Rik,VKORC1L1
    Uniprot Accession Q8N0U8
    Uniprot Entry Name VKORL_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000196715
    Target Classification Not Available

    This gene encodes an enzyme important in the vitamin K cycle, which is involved in the carboxylation of glutamate residues present in vitamin K-dependent proteins. The encoded enzyme catalyzes the de-epoxidation of vitamin K 2,3-epoxide. Oxidative stress may upregulate expression of this gene and the encoded protein may protect cells and membrane proteins form oxidative damage. This gene and a related gene (Gene ID: 79001) may have arisen by gene duplication of an ancestral gene. [provided by RefSeq, Oct 2016]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.