Human TNNT2/CMD1D/CMH2 ORF/cDNA clone-Lentivirus plasmid (NM_001001431)

Cat. No.: pGMLP003317
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human TNNT2/CMD1D/CMH2 Lentiviral expression plasmid for TNNT2 lentivirus packaging, TNNT2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to TNNT2/CMD1D products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $514.5
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP003317
Gene Name TNNT2
Accession Number NM_001001431
Gene ID 7139
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 858 bp
Gene Alias CMD1D,CMH2,CMPD2,cTnT,LVNC6,RCM3,TnTC
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTCTGACATAGAAGAGGTGGTGGAAGAGTACGAGGAGGAGGAGCAGGAAGAAGCAGCTGTTGAAGAGCAGGAGGAGGCAGCGGAAGAGGATGCTGAAGCAGAGGCTGAGACCGAGGAGACCAGGGCAGAAGAAGATGAAGAAGAAGAGGAAGCAAAGGAGGCTGAAGATGGCCCAATGGAGGAGTCCAAACCAAAGCCCAGGTCGTTCATGCCCAACTTGGTGCCTCCCAAGATCCCCGATGGAGAGAGAGTGGACTTTGATGACATCCACCGGAAGCGCATGGAGAAGGACCTGAATGAGTTGCAGGCGCTGATCGAGGCTCACTTTGAGAACAGGAAGAAAGAGGAGGAGGAGCTCGTTTCTCTCAAAGACAGGATCGAGAGACGTCGGGCAGAGCGGGCCGAGCAGCAGCGCATCCGGAATGAGCGGGAGAAGGAGCGGCAGAACCGCCTGGCTGAAGAGAGGGCTCGACGAGAGGAGGAGGAGAACAGGAGGAAGGCTGAGGATGAGGCCCGGAAGAAGAAGGCTTTGTCCAACATGATGCATTTTGGGGGTTACATCCAGAAGACAGAGCGGAAAAGTGGGAAGAGGCAGACTGAGCGGGAAAAGAAGAAGAAGATTCTGGCTGAGAGGAGGAAGGTGCTGGCCATTGACCACCTGAATGAAGATCAGCTGAGGGAGAAGGCCAAGGAGCTGTGGCAGAGCATCTATAACTTGGAGGCAGAGAAGTTCGACCTGCAGGAGAAGTTCAAGCAGCAGAAATATGAGATCAATGTTCTCCGAAACAGGATCAACGATAACCAGAAAGTCTCCAAGACCCGCGGGAAGGCTAAAGTCACCGGGCGCTGGAAATAG
ORF Protein Sequence MSDIEEVVEEYEEEEQEEAAVEEQEEAAEEDAEAEAETEETRAEEDEEEEEAKEAEDGPMEESKPKPRSFMPNLVPPKIPDGERVDFDDIHRKRMEKDLNELQALIEAHFENRKKEEEELVSLKDRIERRRAERAEQQRIRNEREKERQNRLAEERARREEEENRRKAEDEARKKKALSNMMHFGGYIQKTERKSGKRQTEREKKKKILAERRKVLAIDHLNEDQLREKAKELWQSIYNLEAEKFDLQEKFKQQKYEINVLRNRINDNQKVSKTRGKAKVTGRWK

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T05887-Ab Anti-TNNT2 monoclonal antibody
    Target Antigen GM-Tg-g-T05887-Ag TNNT2 protein
    ORF Viral Vector pGMLP003317 Human TNNT2 Lentivirus plasmid
    ORF Viral Vector vGMLP003317 Human TNNT2 Lentivirus particle


    Target information

    Target ID GM-T05887
    Target Name TNNT2
    Gene ID 7139, 21956, 709882, 24837, 493940, 403532, 286816, 100146343
    Gene Symbol and Synonyms CMD1D,CMH2,CMPD2,cTnT,Ctt,CTTG,LVNC6,RATCTTG,RCM3,TNNT2,Tnnt3,Tnt,TnTC
    Uniprot Accession P45379
    Uniprot Entry Name TNNT2_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target, Diagnostics Biomarker
    Disease Not Available
    Gene Ensembl ENSG00000118194
    Target Classification Not Available

    This gene encodes the cardiac isoform of troponin T. The encoded protein is the tropomyosin-binding subunit of the troponin complex, which is located on the thin filament of striated muscles and regulates muscle contraction in response to alterations in intracellular calcium ion concentration. Mutations in this gene have been associated with familial hypertrophic cardiomyopathy as well as with dilated cardiomyopathy. [provided by RefSeq, May 2022]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.