Human FGF9/FGF-9/ GAF ORF/cDNA clone-Lentivirus plasmid (NM_002010)

Pre-made Human FGF9/FGF-9/ GAF Lentiviral expression plasmid for FGF9 lentivirus packaging, FGF9 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to FGF9/FGF-9 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP003449 Human FGF9 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP003449
Gene Name FGF9
Accession Number NM_002010
Gene ID 2254
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 627 bp
Gene Alias FGF-9, GAF, HBFG-9, HBGF-9, SYNS3
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCTCCCTTAGGTGAAGTTGGGAACTATTTCGGTGTGCAGGATGCGGTACCGTTTGGGAATGTGCCCGTGTTGCCGGTGGACAGCCCGGTTTTGTTAAGTGACCACCTGGGTCAGTCCGAAGCAGGGGGGCTCCCCAGGGGACCCGCAGTCACGGACTTGGATCATTTAAAGGGGATTCTCAGGCGGAGGCAGCTATACTGCAGGACTGGATTTCACTTAGAAATCTTCCCCAATGGTACTATCCAGGGAACCAGGAAAGACCACAGCCGATTTGGCATTCTGGAATTTATCAGTATAGCAGTGGGCCTGGTCAGCATTCGAGGCGTGGACAGTGGACTCTACCTCGGGATGAATGAGAAGGGGGAGCTGTATGGATCAGAAAAACTAACCCAAGAGTGTGTATTCAGAGAACAGTTCGAAGAAAACTGGTATAATACGTACTCATCAAACCTATATAAGCACGTGGACACTGGAAGGCGATACTATGTTGCATTAAATAAAGATGGGACCCCGAGAGAAGGGACTAGGACTAAACGGCACCAGAAATTCACACATTTTTTACCTAGACCAGTGGACCCCGACAAAGTACCTGAACTGTATAAGGATATTCTAAGCCAAAGTTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0923-Ab Anti-FGF9/ FGF-9/ GAF functional antibody
    Target Antigen GM-Tg-g-SE0923-Ag FGF9 protein
    Cytokine cks-Tg-g-GM-SE0923 fibroblast growth factor 9 (glia-activating factor) (FGF9) protein & antibody
    ORF Viral Vector pGMLP003449 Human FGF9 Lentivirus plasmid
    ORF Viral Vector vGMLP003449 Human FGF9 Lentivirus particle


    Target information

    Target ID GM-SE0923
    Target Name FGF9
    Gene ID 2254, 14180, 721324, 25444, 101084335, 477340, 613731, 100050353
    Gene Symbol and Synonyms Eks,FGF-9,Fgf4b,FGF9,GAF,HBFG-9,HBGF-9,SYNS3
    Uniprot Accession P31371
    Uniprot Entry Name FGF9_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Cytokine Target
    Disease Not Available
    Gene Ensembl ENSG00000102678
    Target Classification Not Available

    The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. This protein was isolated as a secreted factor that exhibits a growth-stimulating effect on cultured glial cells. In nervous system, this protein is produced mainly by neurons and may be important for glial cell development. Expression of the mouse homolog of this gene was found to be dependent on Sonic hedgehog (Shh) signaling. Mice lacking the homolog gene displayed a male-to-female sex reversal phenotype, which suggested a role in testicular embryogenesis. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.