Human CMA1/chymase/ CYH ORF/cDNA clone-Lentivirus plasmid (NM_001836)
Pre-made Human CMA1/chymase/ CYH Lentiviral expression plasmid for CMA1 lentivirus packaging, CMA1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to CYM/CMA1/chymase products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP003483 | Human CMA1 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP003483 |
Gene Name | CMA1 |
Accession Number | NM_001836 |
Gene ID | 1215 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 744 bp |
Gene Alias | chymase, CYH, MCT1 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGCTGCTTCTTCCTCTCCCCCTGCTGCTCTTTCTCTTGTGCTCCAGAGCTGAAGCTGGGGAGATCATCGGGGGCACAGAATGCAAGCCACATTCCCGCCCCTACATGGCCTACCTGGAAATTGTAACTTCCAACGGTCCCTCAAAATTTTGTGGTGGTTTCCTTATAAGACGGAACTTTGTGCTGACGGCTGCTCATTGTGCAGGAAGGTCTATAACAGTCACCCTTGGAGCCCATAACATAACAGAGGAAGAAGACACATGGCAGAAGCTTGAGGTTATAAAGCAATTCCGTCATCCAAAATATAACACTTCTACTCTTCACCACGATATCATGTTACTAAAGTTGAAGGAGAAAGCCAGCCTGACCCTGGCTGTGGGGACACTCCCCTTCCCATCCCAATTCAACTTTGTCCCACCTGGGAGAATGTGCCGGGTGGCTGGCTGGGGAAGAACAGGTGTGTTGAAGCCGGGCTCAGACACTCTGCAAGAGGTGAAGCTGAGACTCATGGATCCCCAGGCCTGCAGCCACTTCAGAGACTTTGACCACAATCTTCAGCTGTGTGTGGGCAATCCCAGGAAGACAAAATCTGCATTTAAGGGAGACTCTGGGGGCCCTCTTCTGTGTGCTGGGGTGGCCCAGGGCATCGTATCCTATGGACGGTCGGATGCAAAGCCCCCTGCTGTCTTCACCCGAATCTCCCATTACCGGCCCTGGATCAACCAGATCCTGCAGGCAAATTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T05114-Ab | Anti-CMA1/ CYM/ CYH functional antibody |
Target Antigen | GM-Tg-g-T05114-Ag | CYM/CMA1 protein |
ORF Viral Vector | pGMLP003483 | Human CMA1 Lentivirus plasmid |
ORF Viral Vector | vGMLP003483 | Human CMA1 Lentivirus particle |
Target information
Target ID | GM-T05114 |
Target Name | CYM |
Gene ID | 1215, 17228, 716395, 101084796, 490628 |
Gene Symbol and Synonyms | chymase,CMA1,CYH,Mcp-5,Mcp5,Mcpt5,MCT1,MMCP-5 |
Uniprot Accession | P23946 |
Uniprot Entry Name | CMA1_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000092009 |
Target Classification | Not Available |
This gene encodes a chymotryptic serine proteinase that belongs to the peptidase family S1. It is expressed in mast cells and is thought to function in the degradation of the extracellular matrix, the regulation of submucosal gland secretion, and the generation of vasoactive peptides. In the heart and blood vessels, this protein, rather than angiotensin converting enzyme, is largely responsible for converting angiotensin I to the vasoactive peptide angiotensin II. Alternative splicing results in multiple variants. [provided by RefSeq, Apr 2015]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.