Human SGCB/A3b/ LGMD2E ORF/cDNA clone-Lentivirus plasmid (NM_000232)
Pre-made Human SGCB/A3b/ LGMD2E Lentiviral expression plasmid for SGCB lentivirus packaging, SGCB lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to SGCB/A3b products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP003535 | Human SGCB Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP003535 |
Gene Name | SGCB |
Accession Number | NM_000232 |
Gene ID | 6443 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 957 bp |
Gene Alias | A3b, LGMD2E, SGC |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGCGGCAGCGGCGGCGGCGGCTGCAGAACAGCAAAGTTCCAATGGTCCTGTAAAGAAGTCCATGCGTGAGAAGGCTGTTGAGAGAAGGAGTGTCAATAAAGAGCACAACAGTAACTTTAAAGCTGGATACATTCCGATTGATGAAGATCGTCTCCACAAAACAGGGTTGAGAGGAAGAAAGGGCAATTTAGCCATCTGTGTGATTATCCTCTTGTTTATCCTGGCTGTCATCAATTTAATAATAACACTTGTTATTTGGGCCGTGATTCGCATTGGACCAAATGGCTGTGATAGTATGGAGTTTCATGAAAGTGGCCTGCTTCGATTTAAGCAAGTATCTGACATGGGAGTGATCCACCCTCTTTATAAAAGCACAGTAGGAGGAAGGCGAAATGAAAATTTGGTCATCACTGGCAACAACCAGCCTATTGTTTTTCAGCAAGGGACAACAAAGCTCAGTGTAGAAAACAACAAAACTTCTATTACAAGTGACATCGGCATGCAGTTTTTTGACCCGAGGACTCAAAATATCTTATTCAGCACAGACTATGAAACTCATGAGTTTCATTTGCCAAGTGGAGTGAAAAGTTTGAATGTTCAAAAGGCATCTACTGAAAGGATTACCAGCAATGCTACCAGTGATTTAAATATAAAAGTTGATGGGCGTGCTATTGTGCGTGGAAATGAAGGTGTATTCATTATGGGCAAAACCATTGAATTTCACATGGGTGGTAATATGGAGTTAAAGGCGGAAAACAGTATCATCCTAAATGGATCTGTGATGGTCAGCACCACCCGCCTACCCAGTTCCTCCAGTGGAGACCAGTTGGGTAGTGGTGACTGGGTACGCTACAAGCTCTGCATGTGTGCTGATGGGACGCTCTTCAAGGTGCAAGTAACCAGCCAGAACATGGGCTGCCAAATCTCAGACAACCCCTGTGGAAACACTCATTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-IP0033-Ab | Anti-SGCB monoclonal antibody |
Target Antigen | GM-Tg-g-IP0033-Ag | SGCB protein |
ORF Viral Vector | pGMLP003535 | Human SGCB Lentivirus plasmid |
ORF Viral Vector | vGMLP003535 | Human SGCB Lentivirus particle |
Target information
Target ID | GM-IP0033 |
Target Name | SGCB |
Gene ID | 6443, 24051, 702684, 680229, 101087316, 611066, 535372, 100060566 |
Gene Symbol and Synonyms | 43DAG,A3b,beta-SG,LGMD2E,LGMDR4,SGC,SGCB |
Uniprot Accession | Q16585 |
Uniprot Entry Name | SGCB_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000163069 |
Target Classification | Not Available |
This gene encodes a member of the sarcoglycan family. Sarcoglycans are transmembrane components in the dystrophin-glycoprotein complex which help stabilize the muscle fiber membranes and link the muscle cytoskeleton to the extracellular matrix. Mutations in this gene have been associated with limb-girdle muscular dystrophy.[provided by RefSeq, Oct 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.