Human DLK1/Delta1/DLK ORF/cDNA clone-Lentivirus plasmid (NM_003836)

Cat. No.: pGMLP003621
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human DLK1/Delta1/DLK Lentiviral expression plasmid for DLK1 lentivirus packaging, DLK1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to DLK1/Delta1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $622.56
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP003621
Gene Name DLK1
Accession Number NM_003836
Gene ID 8788
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1152 bp
Gene Alias Delta1,DLK,DLK-1,FA1,pG2,Pref-1,PREF1,ZOG
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGACCGCGACCGAAGCCCTCCTGCGCGTCCTCTTGCTCCTGCTGGCTTTCGGCCACAGCACCTATGGGGCTGAATGCTTCCCGGCCTGCAACCCCCAAAATGGATTCTGCGAGGATGACAATGTTTGCAGGTGCCAGCCTGGCTGGCAGGGTCCCCTTTGTGACCAGTGCGTGACCTCTCCCGGCTGCCTTCACGGACTCTGTGGAGAACCCGGGCAGTGCATTTGCACCGACGGCTGGGACGGGGAGCTCTGTGATAGAGATGTTCGGGCCTGCTCCTCGGCCCCCTGTGCCAACAACAGGACCTGCGTGAGCCTGGACGATGGCCTCTATGAATGCTCCTGTGCCCCCGGGTACTCGGGAAAGGACTGCCAGAAAAAGGACGGGCCCTGTGTGATCAACGGCTCCCCCTGCCAGCACGGAGGCACCTGCGTGGATGATGAGGGCCGGGCCTCCCATGCCTCCTGCCTGTGCCCCCCTGGCTTCTCAGGCAATTTCTGCGAGATCGTGGCCAACAGCTGCACCCCCAACCCATGCGAGAACGACGGCGTCTGCACTGACATTGGGGGCGACTTCCGCTGCCGGTGCCCAGCCGGCTTCATCGACAAGACCTGCAGCCGCCCGGTGACCAACTGCGCCAGCAGCCCGTGCCAGAACGGGGGCACCTGCCTGCAGCACACCCAGGTGAGCTACGAGTGTCTGTGCAAGCCCGAGTTCACAGGTCTCACCTGTGTCAAGAAGCGCGCGCTGAGCCCCCAGCAGGTCACCCGTCTGCCCAGCGGCTATGGGCTGGCCTACCGCCTGACCCCTGGGGTGCACGAGCTGCCGGTGCAGCAGCCGGAGCACCGCATCCTGAAGGTGTCCATGAAAGAGCTCAACAAGAAAACCCCTCTCCTCACCGAGGGCCAGGCCATCTGCTTCACCATCCTGGGCGTGCTCACCAGCCTGGTGGTGCTGGGCACTGTGGGTATCGTCTTCCTCAACAAGTGCGAGACCTGGGTGTCCAACCTGCGCTACAACCACATGCTGCGGAAGAAGAAGAACCTGCTGCTTCAGTACAACAGCGGGGAGGACCTGGCCGTCAACATCATCTTCCCCGAGAAGATCGACATGACCACCTTCAGCAAGGAGGCCGGCGACGAGGAGATCTAA
ORF Protein Sequence MTATEALLRVLLLLLAFGHSTYGAECFPACNPQNGFCEDDNVCRCQPGWQGPLCDQCVTSPGCLHGLCGEPGQCICTDGWDGELCDRDVRACSSAPCANNRTCVSLDDGLYECSCAPGYSGKDCQKKDGPCVINGSPCQHGGTCVDDEGRASHASCLCPPGFSGNFCEIVANSCTPNPCENDGVCTDIGGDFRCRCPAGFIDKTCSRPVTNCASSPCQNGGTCLQHTQVSYECLCKPEFTGLTCVKKRALSPQQVTRLPSGYGLAYRLTPGVHELPVQQPEHRILKVSMKELNKKTPLLTEGQAICFTILGVLTSLVVLGTVGIVFLNKCETWVSNLRYNHMLRKKKNLLLQYNSGEDLAVNIIFPEKIDMTTFSKEAGDEEI

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0084-Ab Anti-DLK1 monoclonal antibody
    Target Antigen GM-Tg-g-IP0084-Ag DLK1 protein
    ORF Viral Vector pGMLP003621 Human DLK1 Lentivirus plasmid
    ORF Viral Vector pGMLV001175 Human DLK1 Lentivirus plasmid
    ORF Viral Vector vGMLP003621 Human DLK1 Lentivirus particle
    ORF Viral Vector vGMLV001175 Human DLK1 Lentivirus particle


    Target information

    Target ID GM-IP0084
    Target Name DLK1
    Gene ID 8788, 13386, 707595, 114587, 101081814, 490860, 281117, 100054933
    Gene Symbol and Synonyms Delta1,DLK,DLK-1,DLK1,DlkI,FA1,Ly107,Peg9,pG2,Pref-1,PREF1,SCP1,ZOG
    Uniprot Accession P80370
    Uniprot Entry Name DLK1_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000185559
    Target Classification Tumor-associated antigen (TAA)

    This gene encodes a transmembrane protein that contains multiple epidermal growth factor repeats that functions as a regulator of cell growth. The encoded protein is involved in the differentiation of several cell types including adipocytes. This gene is located in a region of chromosome 14 frequently showing unparental disomy, and is imprinted and expressed from the paternal allele. A single nucleotide variant in this gene is associated with child and adolescent obesity and shows polar overdominance, where heterozygotes carrying an active paternal allele express the phenotype, while mutant homozygotes are normal. [provided by RefSeq, Nov 2015]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.