Human UGCG/GCS/ GLCT1 ORF/cDNA clone-Lentivirus plasmid (NM_003358)

Pre-made Human UGCG/GCS/ GLCT1 Lentiviral expression plasmid for UGCG lentivirus packaging, UGCG lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to UGCG/GCS products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP003640 Human UGCG Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP003640
Gene Name UGCG
Accession Number NM_003358
Gene ID 7357
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1185 bp
Gene Alias GCS, GLCT1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCGCTGCTGGACCTGGCCTTGGAGGGAATGGCCGTCTTCGGGTTCGTCCTCTTCTTGGTGCTGTGGCTGATGCATTTCATGGCTATCATCTACACCCGATTACACCTCAACAAGAAGGCAACTGACAAACAGCCTTATAGCAAGCTCCCAGGTGTCTCTCTTCTGAAACCACTGAAAGGGGTAGATCCTAACTTAATCAACAACCTGGAAACATTCTTTGAATTGGATTATCCCAAATATGAAGTGCTCCTTTGTGTACAAGATCATGATGATCCAGCCATTGATGTATGTAAGAAGCTTCTTGGAAAATATCCAAATGTTGATGCTAGATTGTTTATAGGTGGCAAAAAAGTTGGCATTAATCCTAAAATTAATAATTTAATGCCAGGATATGAAGTTGCAAAGTATGATCTTATATGGATTTGTGATAGTGGAATAAGAGTAATTCCAGATACGCTTACTGACATGGTGAATCAAATGACAGAAAAAGTAGGCTTGGTTCACGGGCTGCCTTACGTAGCAGACAGACAGGGCTTTGCTGCCACCTTAGAGCAGGTATATTTTGGAACTTCACATCCAAGATACTATATCTCTGCCAATGTAACTGGTTTCAAATGTGTGACAGGAATGTCTTGTTTAATGAGAAAAGATGTGTTGGATCAAGCAGGAGGACTTATAGCTTTTGCTCAGTACATTGCCGAAGATTACTTTATGGCCAAAGCGATAGCTGACCGAGGTTGGAGGTTTGCAATGTCCACTCAAGTTGCAATGCAAAACTCTGGCTCATATTCAATTTCTCAGTTTCAATCCAGAATGATCAGGTGGACCAAACTACGAATTAACATGCTTCCTGCTACAATAATTTGTGAGCCAATTTCAGAATGCTTTGTTGCCAGTTTAATTATTGGATGGGCAGCCCACCATGTGTTCAGATGGGATATTATGGTATTTTTCATGTGTCATTGCCTGGCATGGTTTATATTTGACTACATTCAACTCAGGGGTGTCCAGGGTGGCACACTGTGTTTTTCAAAACTTGATTATGCAGTCGCCTGGTTCATCCGCGAATCCATGACAATATACATTTTTTTGTCTGCATTATGGGACCCAACTATAAGCTGGAGAACTGGTCGCTACAGATTACGCTGTGGGGGTACAGCAGAGGAAATCCTAGATGTATAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0022-Ab Anti-UGCG monoclonal antibody
    Target Antigen GM-Tg-g-IP0022-Ag UGCG protein
    ORF Viral Vector pGMLP003640 Human UGCG Lentivirus plasmid
    ORF Viral Vector vGMLP003640 Human UGCG Lentivirus particle


    Target information

    Target ID GM-IP0022
    Target Name UGCG
    Gene ID 7357, 22234, 707875, 83626, 101101006, 481666, 514357, 100057611
    Gene Symbol and Synonyms Epcs21,GCS,GlcT-1,GLCT1,UGCG,Ugcgl
    Uniprot Accession Q16739
    Uniprot Entry Name CEGT_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000148154
    Target Classification Not Available

    This gene encodes an enzyme that catalyzes the first glycosylation step in the biosynthesis of glycosphingolipids, which are membrane components containing lipid and sugar moieties. The product of this reaction is glucosylceramide, which is the core structure of many glycosphingolipids. [provided by RefSeq, Dec 2014]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.