Human DCTN6/p27/WS-3 ORF/cDNA clone-Lentivirus plasmid (NM_006571)
Cat. No.: pGMLP003796
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human DCTN6/p27/WS-3 Lentiviral expression plasmid for DCTN6 lentivirus packaging, DCTN6 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
DCTN6/p27 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP003796 |
Gene Name | DCTN6 |
Accession Number | NM_006571 |
Gene ID | 10671 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 573 bp |
Gene Alias | p27,WS-3,WS3 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGGCGGAGAAGACTCAAAAGAGTGTGAAGATTGCTCCTGGAGCAGTTGTATGTGTAGAAAGTGAAATCAGAGGAGATGTAACTATCGGACCTCGGACAGTGATCCACCCTAAAGCAAGAATTATTGCGGAAGCCGGGCCAATAGTGATTGGCGAAGGGAACCTAATAGAAGAACAGGCCCTTATCATAAATGCTTACCCAGATAATATCACTCCTGACACTGAAGATCCAGAACCAAAACCTATGATCATTGGCACCAATAATGTGTTTGAAGTTGGCTGTTATTCCCAAGCCATGAAGATGGGAGATAATAATGTCATTGAATCAAAAGCATATGTAGGCAGAAATGTAATATTGACAAGTGGCTGCATCATTGGGGCTTGTTGCAACCTAAATACATTTGAAGTCATCCCTGAGAATACGGTGATCTATGGTGCAGACTGCCTTCGTCGGGTGCAGACTGAGCGACCGCAGCCCCAGACACTACAGCTGGATTTCTTGATGAAAATCTTGCCAAATTACCACCACCTAAAGAAGACTATGAAAGGAAGCTCAACTCCAGTAAAGAACTAA |
ORF Protein Sequence | MAEKTQKSVKIAPGAVVCVESEIRGDVTIGPRTVIHPKARIIAEAGPIVIGEGNLIEEQALIINAYPDNITPDTEDPEPKPMIIGTNNVFEVGCYSQAMKMGDNNVIESKAYVGRNVILTSGCIIGACCNLNTFEVIPENTVIYGADCLRRVQTERPQPQTLQLDFLMKILPNYHHLKKTMKGSSTPVKN |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-IP2447-Ab | Anti-DCTN6 monoclonal antibody |
Target Antigen | GM-Tg-g-IP2447-Ag | DCTN6 protein |
ORF Viral Vector | pGMLP003796 | Human DCTN6 Lentivirus plasmid |
ORF Viral Vector | vGMLP003796 | Human DCTN6 Lentivirus particle |
Target information
Target ID | GM-IP2447 |
Target Name | DCTN6 |
Gene ID | 10671, 22428, 694273, 290798, 101089348, 475600, 513751, 100058409 |
Gene Symbol and Synonyms | DCTN6,p27,WS-3,WS3 |
Uniprot Accession | O00399 |
Uniprot Entry Name | DCTN6_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000104671 |
Target Classification | Not Available |
The protein encoded by this gene contains an RGD (Arg-Gly-Asp) motif in the N-terminal region, which confers adhesive properties to macromolecular proteins like fibronectin. It shares a high degree of sequence similarity with the mouse homolog, which has been suggested to play a role in mitochondrial biogenesis. The exact biological function of this gene is not known. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.