Human DCTN6/p27/WS-3 ORF/cDNA clone-Lentivirus plasmid (NM_006571)

Cat. No.: pGMLP003796
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human DCTN6/p27/WS-3 Lentiviral expression plasmid for DCTN6 lentivirus packaging, DCTN6 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to DCTN6/p27 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $443.25
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP003796
Gene Name DCTN6
Accession Number NM_006571
Gene ID 10671
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 573 bp
Gene Alias p27,WS-3,WS3
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCGGAGAAGACTCAAAAGAGTGTGAAGATTGCTCCTGGAGCAGTTGTATGTGTAGAAAGTGAAATCAGAGGAGATGTAACTATCGGACCTCGGACAGTGATCCACCCTAAAGCAAGAATTATTGCGGAAGCCGGGCCAATAGTGATTGGCGAAGGGAACCTAATAGAAGAACAGGCCCTTATCATAAATGCTTACCCAGATAATATCACTCCTGACACTGAAGATCCAGAACCAAAACCTATGATCATTGGCACCAATAATGTGTTTGAAGTTGGCTGTTATTCCCAAGCCATGAAGATGGGAGATAATAATGTCATTGAATCAAAAGCATATGTAGGCAGAAATGTAATATTGACAAGTGGCTGCATCATTGGGGCTTGTTGCAACCTAAATACATTTGAAGTCATCCCTGAGAATACGGTGATCTATGGTGCAGACTGCCTTCGTCGGGTGCAGACTGAGCGACCGCAGCCCCAGACACTACAGCTGGATTTCTTGATGAAAATCTTGCCAAATTACCACCACCTAAAGAAGACTATGAAAGGAAGCTCAACTCCAGTAAAGAACTAA
ORF Protein Sequence MAEKTQKSVKIAPGAVVCVESEIRGDVTIGPRTVIHPKARIIAEAGPIVIGEGNLIEEQALIINAYPDNITPDTEDPEPKPMIIGTNNVFEVGCYSQAMKMGDNNVIESKAYVGRNVILTSGCIIGACCNLNTFEVIPENTVIYGADCLRRVQTERPQPQTLQLDFLMKILPNYHHLKKTMKGSSTPVKN

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP2447-Ab Anti-DCTN6 monoclonal antibody
    Target Antigen GM-Tg-g-IP2447-Ag DCTN6 protein
    ORF Viral Vector pGMLP003796 Human DCTN6 Lentivirus plasmid
    ORF Viral Vector vGMLP003796 Human DCTN6 Lentivirus particle


    Target information

    Target ID GM-IP2447
    Target Name DCTN6
    Gene ID 10671, 22428, 694273, 290798, 101089348, 475600, 513751, 100058409
    Gene Symbol and Synonyms DCTN6,p27,WS-3,WS3
    Uniprot Accession O00399
    Uniprot Entry Name DCTN6_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000104671
    Target Classification Not Available

    The protein encoded by this gene contains an RGD (Arg-Gly-Asp) motif in the N-terminal region, which confers adhesive properties to macromolecular proteins like fibronectin. It shares a high degree of sequence similarity with the mouse homolog, which has been suggested to play a role in mitochondrial biogenesis. The exact biological function of this gene is not known. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.