Human NSG1/D4S234/D4S234E ORF/cDNA clone-Lentivirus plasmid (NM_001287763)

Cat. No.: pGMLP003807
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human NSG1/D4S234/D4S234E Lentiviral expression plasmid for NSG1 lentivirus packaging, NSG1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to NSG1/D4S234 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $439.5
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP003807
Gene Name NSG1
Accession Number NM_001287763
Gene ID 27065
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 558 bp
Gene Alias D4S234,D4S234E,NEEP21,P21
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGTGAAGTTGGGGAACAATTTCGCAGAGAAGGGCACCAAGCAGCCGCTGCTGGAGGATGGCTTCGACACCATTCCCCTGATGACGCCCCTCGATGTCAATCAGCTGCAGTTCCCGCCCCCGGATAAGGTGGTCGTGAAAACTAAGACCGAGTATGAACCTGACCGCAAGAAAGGGAAAGCACGTCCTCCCCAAATTGCTGAGTTCACCGTCAGCATCACGGAGGGTGTCACCGAGAGGTTTAAGGTCTCCGTGTTGGTCCTCTTCGCCCTGGCCTTCCTCACCTGCGTCGTCTTCCTGGTTGTCTACAAGGTGTACAAGTATGACCGCGCCTGCCCCGATGGGTTCGTCCTCAAGAACACCCAGTGCATCCCAGAAGGCTTGGAGAGCTACTACGCGGAGCAAGACTCCAGTGCCCGGGAGAAATTTTACACAGTCATAAACCACTACAACCTGGCCAAGCAGAGCATCACGCGCTCCGTATCGCCCTGGATGTCAGTTCTGTCAGAAGAGAAGCTGTCCGAGCAGGAGACTGAAGCGGCTGAGAAGTCAGCTTAG
ORF Protein Sequence MVKLGNNFAEKGTKQPLLEDGFDTIPLMTPLDVNQLQFPPPDKVVVKTKTEYEPDRKKGKARPPQIAEFTVSITEGVTERFKVSVLVLFALAFLTCVVFLVVYKVYKYDRACPDGFVLKNTQCIPEGLESYYAEQDSSAREKFYTVINHYNLAKQSITRSVSPWMSVLSEEKLSEQETEAAEKSA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP1283-Ab Anti-NSG1 monoclonal antibody
    Target Antigen GM-Tg-g-IP1283-Ag NSG1 protein
    ORF Viral Vector pGMLP003807 Human NSG1 Lentivirus plasmid
    ORF Viral Vector vGMLP003807 Human NSG1 Lentivirus particle


    Target information

    Target ID GM-IP1283
    Target Name NSG1
    Gene ID 27065, 18196, 712289, 25247, 101091018, 479096, 523110, 100069677
    Gene Symbol and Synonyms Bsmrb,D4S234,D4S234E,m234,NEEP21,NSG1,P21,PEP1
    Uniprot Accession P42857
    Uniprot Entry Name NSG1_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000168824
    Target Classification Not Available

    Predicted to enable clathrin light chain binding activity. Involved in apoptotic process. Located in endoplasmic reticulum. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.