Human LRRC59/p34/PRO1855 ORF/cDNA clone-Lentivirus plasmid (NM_018509)

Cat. No.: pGMLP003838
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human LRRC59/p34/PRO1855 Lentiviral expression plasmid for LRRC59 lentivirus packaging, LRRC59 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to LRRC59/p34 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $531
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP003838
Gene Name LRRC59
Accession Number NM_018509
Gene ID 55379
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 924 bp
Gene Alias p34,PRO1855
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGACCAAGGCCGGTAGCAAGGGCGGGAACCTCCGCGACAAGCTGGACGGCAACGAACTGGACCTGAGCCTCAGCGACCTGAATGAGGTCCCGGTGAAGGAGCTGGCTGCCCTTCCAAAGGCCACCATCCTGGATCTGTCTTGTAATAAACTGACTACTCTACCGTCGGATTTCTGTGGCCTCACACACCTGGTGAAGCTAGACCTGAGTAAGAACAAGCTGCAGCAGCTGCCAGCAGACTTTGGCCGTCTGGTCAACCTCCAGCACCTGGATCTCCTCAACAACAAGCTGGTCACCTTGCCTGTCAGCTTTGCTCAGCTCAAGAACCTGAAGTGGTTGGACCTGAAGGATAACCCCCTGGATCCTGTCCTGGCCAAGGTGGCAGGTGACTGCTTGGATGAGAAGCAGTGTAAGCAGTGTGCAAACAAGGTGTTACAGCACATGAAGGCCGTGCAGGCAGATCAGGAGCGGGAGAGGCAGCGGCGGCTGGAAGTAGAACGTGAGGCAGAGAAGAAGCGTGAGGCTAAGCAGCGAGCTAAGGAAGCTCAGGAGCGGGAACTGCGGAAGCGGGAGAAGGCGGAAGAGAAGGAGCGCCGGAGAAAGGAGTATGATGCCCTCAAAGCAGCCAAGCGGGAGCAGGAGAAGAAACCTAAGAAGGAAGCAAATCAGGCCCCGAAATCTAAGTCTGGCTCCCGTCCCCGCAAGCCACCACCCCGGAAGCACACTCGTTCCTGGGCTGTGCTGAAGCTGCTGCTGCTGCTGCTGCTATTTGGTGTGGCGGGAGGGCTGGTTGCTTGTCGGGTGACAGAGCTGCAGCAGCAGCCCCTCTGCACCAGCGTGAACACCATCTATGACAATGCGGTCCAGGGTCTACGCCGCCATGAGATCCTCCAGTGGGTCCTCCAGACCGACTCTCAGCAGTGA
ORF Protein Sequence MTKAGSKGGNLRDKLDGNELDLSLSDLNEVPVKELAALPKATILDLSCNKLTTLPSDFCGLTHLVKLDLSKNKLQQLPADFGRLVNLQHLDLLNNKLVTLPVSFAQLKNLKWLDLKDNPLDPVLAKVAGDCLDEKQCKQCANKVLQHMKAVQADQERERQRRLEVEREAEKKREAKQRAKEAQERELRKREKAEEKERRRKEYDALKAAKREQEKKPKKEANQAPKSKSGSRPRKPPPRKHTRSWAVLKLLLLLLLFGVAGGLVACRVTELQQQPLCTSVNTIYDNAVQGLRRHEILQWVLQTDSQQ

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP1121-Ab Anti-LRRC59 monoclonal antibody
    Target Antigen GM-Tg-g-IP1121-Ag LRRC59 protein
    ORF Viral Vector pGMLP003838 Human LRRC59 Lentivirus plasmid
    ORF Viral Vector vGMLP003838 Human LRRC59 Lentivirus particle


    Target information

    Target ID GM-IP1121
    Target Name LRRC59
    Gene ID 55379, 98238, 705396, 287633, 101090911, 491080, 532659, 100069924
    Gene Symbol and Synonyms LRRC59,p34,PRO1855
    Uniprot Accession Q96AG4
    Uniprot Entry Name LRC59_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000108829
    Target Classification Not Available

    Enables RNA binding activity and cadherin binding activity. Predicted to be involved in positive regulation of Ras protein signal transduction and signal transduction. Located in endoplasmic reticulum and mitochondrial nucleoid. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.