Human CPB2/CPU/PCPB ORF/cDNA clone-Lentivirus plasmid (BC007057)

Cat. No.: pGMLP003892
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human CPB2/CPU/PCPB Lentiviral expression plasmid for CPB2 lentivirus packaging, CPB2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to CPB2/CPU products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $656.16
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP003892
Gene Name CPB2
Accession Number BC007057
Gene ID 1361
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1272 bp
Gene Alias CPU,PCPB,TAFI
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAAGCTTTGCAGCCTTGCAGTCCTTGTACCCATTGTTCTCTTCTGTGAGCAGCATGTCTTCGCGTTTCAGAGTGGCCAAGTTCTAGCTGCTCTTCCTAGAACCTCTAGGCAAGTTCAAGTTCTACAGAATCTTACTACAACATATGAGATTGTTCTCTGGCAGCCGGTAACAGCTGACCTTATTGTGAAGAAAAAACAAGTCCATTTTTTTGTAAATGCATCTGATGTCGACAATGTGAAAGCCCATTTAAATGTGAGCGGAATTCCATGCAGTGTCTTGCTGGCAGACGTGGAAGATCTTATTCAACAGCAGATTTCCAACGACACAGTCAGCCCCCGAGCCTCCGCATCGTACTATGAACAGTATCACTCACTAAATGAAATCTATTCTTGGATAGAATTTATAACTGAGAGGCATCCTGATATGCTTACAAAAATCCACATTGGATCCTCATTTGAGAAGTACCCACTCTATGTTTTAAAGGTTTCTGGAAAAGAACAAGCAGCCAAAAATGCCATATGGATTGACTGTGGAATCCATGCCAGAGAATGGATCTCTCCTGCTTTCTGCTTGTGGTTCATAGGCCATATAACTCAATTCTATGGGATAATAGGGCAATATACCAATCTCCTGAGGCTTGTGGATTTCTATGTTATGCCGGTGGTTAATGTGGATGGTTATGACTACTCATGGAAAAAGAATCGAATGTGGAGAAAGAACCGTTCTTTCTATGCGAACAATCATTGCATCGGAACAGACCTGAATAGGAACTTTGCTTCCAAACACTGGTGTGAGGAAGGTGCATCCAGTTCCTCATGCTCGGAAACCTACTGTGGACTTTATCCTGAGTCAGAACCAGAAGTGAAGGCAGTGGCTAGTTTCTTGAGAAGAAATATCAACCAGATTAAAGCATACATCAGCATGCATTCATACTCCCAGCATATAGTGTTTCCATATTCCTATACACGAAGTAAAAGCAAAGACCATGAGGAACTGTCTCTAGTAGCCAGTGAAGCAGTTCGTGCTATTGAGAAAACTAGTAAAAATACCAGGTATACACATGGCCATGGCTCAGAAACCTTATACCTAGCTCCTGGAGGTGGGGACGATTGGATCTATGATTTGGGCATCAAATATTCGTTTACAATTGAACTTCGAGATACGGGCACATACGGATTCTTGCTGCCGGAGCGTTACATCAAACCCACCTGTAGAGAAGCTTTTGCCGCTGTCTCTAAAATAGCTTGGCATGTCATTAGGAATGTTTAA
ORF Protein Sequence MKLCSLAVLVPIVLFCEQHVFAFQSGQVLAALPRTSRQVQVLQNLTTTYEIVLWQPVTADLIVKKKQVHFFVNASDVDNVKAHLNVSGIPCSVLLADVEDLIQQQISNDTVSPRASASYYEQYHSLNEIYSWIEFITERHPDMLTKIHIGSSFEKYPLYVLKVSGKEQAAKNAIWIDCGIHAREWISPAFCLWFIGHITQFYGIIGQYTNLLRLVDFYVMPVVNVDGYDYSWKKNRMWRKNRSFYANNHCIGTDLNRNFASKHWCEEGASSSSCSETYCGLYPESEPEVKAVASFLRRNINQIKAYISMHSYSQHIVFPYSYTRSKSKDHEELSLVASEAVRAIEKTSKNTRYTHGHGSETLYLAPGGGDDWIYDLGIKYSFTIELRDTGTYGFLLPERYIKPTCREAFAAVSKIAWHVIRNV

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T98022-Ab Anti-CBPB2/ CPB2/ CPU functional antibody
    Target Antigen GM-Tg-g-T98022-Ag CPB2 protein
    ORF Viral Vector pGMLP003892 Human CPB2 Lentivirus plasmid
    ORF Viral Vector vGMLP003892 Human CPB2 Lentivirus particle


    Target information

    Target ID GM-T98022
    Target Name CPB2
    Gene ID 1361, 56373, 703317, 113936, 101082116, 608910, 508222, 100058534
    Gene Symbol and Synonyms 1110032P04Rik,4930405E17Rik,CPB2,CPR,CPU,PCPB,TAFI
    Uniprot Accession Q96IY4
    Uniprot Entry Name CBPB2_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000080618
    Target Classification Not Available

    Carboxypeptidases are enzymes that hydrolyze C-terminal peptide bonds. The carboxypeptidase family includes metallo-, serine, and cysteine carboxypeptidases. According to their substrate specificity, these enzymes are referred to as carboxypeptidase A (cleaving aliphatic residues) or carboxypeptidase B (cleaving basic amino residues). The protein encoded by this gene is activated by trypsin and acts on carboxypeptidase B substrates. After thrombin activation, the mature protein downregulates fibrinolysis. Polymorphisms have been described for this gene and its promoter region. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jun 2013]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.