Human SERPINA5/PAI3/PROCI ORF/cDNA clone-Lentivirus plasmid (BC008915)

Cat. No.: pGMLP003895
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human SERPINA5/PAI3/PROCI Lentiviral expression plasmid for SERPINA5 lentivirus packaging, SERPINA5 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to SERPINA5/PAI3 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $641.88
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP003895
Gene Name SERPINA5
Accession Number BC008915
Gene ID 5104
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1221 bp
Gene Alias PAI3,PROCI
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCAGCTCTTCCTCCTCTTGTGCCTGGTGCTTCTCAGCCCTCAGGGGGCCTCCCTTCACCGCCACCACCCCCGGGAGATGAAGAAGAGAGTCGAGGACCTCCATGTAGGTGCCACGGTGGCCCCCAGCAGCAGAAGGGACTTTACCTTTGACCTCTACAGGGCCTTGGCTTCCGCTGCCCCCAGCCAGAACATCTTCTTCTCCCCTGTGAGCATCTCCATGAGCCTGGCCATGCTCTCCCTGGGGGCTGGGTCCAGCACAAAGATGCAGATCCTGGAGGGCCTGGGCCTCAACCTCCAGAAAAGCTCAGAGAAGGAGCTGCACAGAGGCTTTCAGCAGCTCCTTCAGGAACTCAACCAGCCCAGAGATGGCTTCCAGCTGAGCCTCGGCAATGCCCTTTTCACCGACCTGGTGGTAGACCTGCAGGACACCTTCGTAAGTGCCATGAAGACGCTGTACCTGGCAGACACTTTCCCCACCAACTTTAGGGACTCTGCAGGGGCCATGAAGCAGATCAATGATTATGTGGCAAAGCAAACGAAGGGCAAGATTGTGGACTTGCTTAAGAACCTCGATAGCAATGCGGTCGTGATCATGGTGAATTACATCTTCTTTAAAGCTAAGTGGGAGACAAGCTTCAACCACAAAGGCACCCAAGAGCAAGACTTCTACGTGACCTCGGAGACTGTGGTGCGGGTACCCATGATGAGCCGCGAGGATCAGTATCACTACCTCCTGGACCGGAACCTCTCCTGCAGGGTGGTGGGGGTCCCCTACCAAGGCAATGCCACGGCTTTGTTCATTCTCCCCAGTGAGGGAAAGATGCAGCAGGTGGAGAATGGACTGAGTGAGAAAACGCTGAGGAAGTGGCTTAAGATGTTCAAAAAGAGGCAGCTCGAGCTTTACCTTCCCAAATTCTCCATTGAGGGCTCCTATCAGCTGGAGAAAGTCCTCCCCAGTCTGGGGATCAGTAACGTCTTCACCTCCCATGCTGATCTGTCCGGCATCAGCAACCACTCAAATATCCAGGTGTCTGAGATGGTGCACAAAGCTGTGGTGGAGGTGGACGAGTCGGGAACCAGAGCAGCGGCAGCCACGGGGACAATCTTCACTTTCAGGTCGGCCCGCCTGAACTCTCAGAGGCTAGTGTTCAACAGGCCCTTTCTGATGTTCATTGTGGATAACAACATCCTCTTCCTTGGCAAAGTGAACCGCCCCTGA
ORF Protein Sequence MQLFLLLCLVLLSPQGASLHRHHPREMKKRVEDLHVGATVAPSSRRDFTFDLYRALASAAPSQNIFFSPVSISMSLAMLSLGAGSSTKMQILEGLGLNLQKSSEKELHRGFQQLLQELNQPRDGFQLSLGNALFTDLVVDLQDTFVSAMKTLYLADTFPTNFRDSAGAMKQINDYVAKQTKGKIVDLLKNLDSNAVVIMVNYIFFKAKWETSFNHKGTQEQDFYVTSETVVRVPMMSREDQYHYLLDRNLSCRVVGVPYQGNATALFILPSEGKMQQVENGLSEKTLRKWLKMFKKRQLELYLPKFSIEGSYQLEKVLPSLGISNVFTSHADLSGISNHSNIQVSEMVHKAVVEVDESGTRAAAATGTIFTFRSARLNSQRLVFNRPFLMFIVDNNILFLGKVNRP

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-TA156-Ab Anti-IPSP/ SERPINA5/ PAI-3 functional antibody
    Target Antigen GM-Tg-g-TA156-Ag SERPINA5 protein
    ORF Viral Vector pGMLP002809 Human SERPINA5 Lentivirus plasmid
    ORF Viral Vector pGMLP003895 Human SERPINA5 Lentivirus plasmid
    ORF Viral Vector vGMLP002809 Human SERPINA5 Lentivirus particle
    ORF Viral Vector vGMLP003895 Human SERPINA5 Lentivirus particle


    Target information

    Target ID GM-TA156
    Target Name SERPINA5
    Gene ID 5104, 702078, 65051, 101081903, 480424, 112441462, 100065370
    Gene Symbol and Synonyms PAI-3,PAI3,PCI,PCI-B,PLANH3,PROCI,SERPINA5
    Uniprot Accession P05154
    Uniprot Entry Name IPSP_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000188488
    Target Classification Not Available

    The protein encoded by this gene is a member of the serpin family of proteins, a group of proteins that inhibit serine proteases. This gene is one in a cluster of serpin genes located on the q arm of chromosome 14. This family member is a glycoprotein that can inhibit several serine proteases, including protein C and various plasminogen activators and kallikreins, and it thus plays diverse roles in hemostasis and thrombosis in multiple organs. [provided by RefSeq, Aug 2012]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.