Human CD37/GP52-40/TSPAN26 ORF/cDNA clone-Lentivirus plasmid (NM_001774)

Cat. No.: pGMLP003946
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human CD37/GP52-40/TSPAN26 Lentiviral expression plasmid for CD37 lentivirus packaging, CD37 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to CD37/GP52-40 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $511.5
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP003946
Gene Name CD37
Accession Number NM_001774
Gene ID 951
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 846 bp
Gene Alias GP52-40,TSPAN26
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTCAGCCCAGGAGAGCTGCCTCAGCCTCATCAAGTACTTCCTCTTCGTTTTCAACCTCTTCTTCTTCGTCCTCGGCAGCCTGATCTTCTGCTTCGGCATCTGGATCCTCATTGACAAGACCAGCTTCGTGTCCTTTGTGGGCTTGGCCTTCGTGCCTCTGCAGATCTGGTCCAAAGTCCTGGCCATCTCAGGAATCTTCACCATGGGCATCGCCCTCCTGGGTTGTGTGGGGGCCCTCAAGGAGCTCCGCTGCCTCCTGGGCCTGTATTTTGGGATGCTGCTGCTCCTGTTTGCCACACAGATCACCCTGGGAATCCTCATCTCCACTCAGCGGGCCCAGCTGGAGCGAAGCTTGCGGGACGTCGTAGAGAAAACCATCCAAAAGTACGGCACCAACCCCGAGGAGACCGCGGCCGAGGAGAGCTGGGACTATGTGCAGTTCCAGCTGCGCTGCTGCGGCTGGCACTACCCGCAGGACTGGTTCCAAGTCCTCATCCTGAGAGGTAACGGGTCGGAGGCGCACCGCGTGCCCTGCTCCTGCTACAACTTGTCGGCGACCAACGACTCCACAATCCTAGATAAGGTGATCTTGCCCCAGCTCAGCAGGCTTGGACACCTGGCGCGGTCCAGACACAGTGCAGACATCTGCGCTGTCCCTGCAGAGAGCCACATCTACCGCGAGGGCTGCGCGCAGGGCCTCCAGAAGTGGCTGCACAACAACCTTATTTCCATAGTGGGCATTTGCCTGGGCGTCGGCCTACTCGAGCTCGGGTTCATGACGCTCTCGATATTCCTGTGCAGAAACCTGGACCACGTCTACAACCGGCTCGCTCGATACCGTTAG
ORF Protein Sequence MSAQESCLSLIKYFLFVFNLFFFVLGSLIFCFGIWILIDKTSFVSFVGLAFVPLQIWSKVLAISGIFTMGIALLGCVGALKELRCLLGLYFGMLLLLFATQITLGILISTQRAQLERSLRDVVEKTIQKYGTNPEETAAEESWDYVQFQLRCCGWHYPQDWFQVLILRGNGSEAHRVPCSCYNLSATNDSTILDKVILPQLSRLGHLARSRHSADICAVPAESHIYREGCAQGLQKWLHNNLISIVGICLGVGLLELGFMTLSIFLCRNLDHVYNRLARYR

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-364 Pre-Made Naratuximab biosimilar, Whole mAb ADC, Anti-CD37 Antibody: Anti-GP52-40/TSPAN26 therapeutic antibody
    Biosimilar GMP-Bios-ab-313 Pre-Made Lilotomab biosimilar, Whole mAb ADC, Anti-CD37 Antibody: Anti-GP52-40/TSPAN26 therapeutic antibody
    Biosimilar GMP-Bios-ab-416 Pre-Made Otlertuzumab biosimilar, di-scFv+Fc, Anti-CD37 Antibody: Anti-GP52-40/TSPAN26 therapeutic antibody
    Biosimilar GMP-Bios-INN-904 Pre-Made Lutetium (177Lu) Lilotomab Satetraxetan Biosimilar, Radiolabelled Antibody, Anti-Cd37 Antibody: Anti-GP52-40/TSPAN26 therapeutic antibody
    Biosimilar GMP-Bios-INN-924 Pre-Made Naratuximab Emtansine Biosimilar, Whole Mab Adc, Anti-Cd37 Antibody: Anti-GP52-40/TSPAN26 therapeutic antibody Drug Conjugate
    Biosimilar GMP-Bios-ab-673 Pre-Made Ivicentamab biosimilar, Whole mAb, Anti-CD37;CD37 Antibody: Anti-GP52-40/TSPAN26;GP52-40/TSPAN26 therapeutic antibody
    Target Antibody GM-Tg-g-IP0074-Ab Anti-CD37 monoclonal antibody
    Target Antigen GM-Tg-g-IP0074-Ag CD37 protein
    ORF Viral Vector pGMLP003946 Human CD37 Lentivirus plasmid
    ORF Viral Vector vGMLP003946 Human CD37 Lentivirus particle


    Target information

    Target ID GM-IP0074
    Target Name CD37
    Gene ID 951, 12493, 718718, 29185, 101099165, 484382, 508751, 100055274
    Gene Symbol and Synonyms CD37,GP52-40,TSPAN26
    Uniprot Accession P11049
    Uniprot Entry Name CD37_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target, Immuno-oncology Target, INN Index
    Disease Not Available
    Gene Ensembl ENSG00000104894
    Target Classification Checkpoint-Immuno Oncology

    The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein is a cell surface glycoprotein that is known to complex with integrins and other transmembrane 4 superfamily proteins. It may play a role in T-cell-B-cell interactions. Alternate splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.