Human B3GAT1/CD57/GLCATP ORF/cDNA clone-Lentivirus plasmid (NM_054025)
Cat. No.: pGMLP004112
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human B3GAT1/CD57/GLCATP Lentiviral expression plasmid for B3GAT1 lentivirus packaging, B3GAT1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
B3GAT1/CD57 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP004112 |
Gene Name | B3GAT1 |
Accession Number | NM_054025 |
Gene ID | 27087 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1005 bp |
Gene Alias | CD57,GLCATP,GLCUATP,HNK1,LEU7,NK-1,NK1 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGCCGAAGAGACGGGACATCCTAGCGATCGTCCTCATCGTGCTGCCCTGGACTCTGCTCATCACTGTCTGGCACCAGAGCACCCTCGCACCCCTGCTCGCGGTACATAAGGATGAGGGCAGTGACCCCCGACGCGAAACGCCGCCCGGCGCCGACCCCAGGGAGTACTGCACGTCTGACCGCGACATCGTGGAGGTGGTGCGCACCGAGTACGTGTACACGCGGCCCCCGCCATGGTCCGACACGCTGCCCACCATCCACGTGGTGACGCCCACCTACAGCCGCCCGGTGCAGAAGGCCGAGCTGACGCGCATGGCCAACACGCTGCTGCACGTGCCCAACCTCCACTGGCTGGTGGTGGAGGATGCGCCGCGCCGGACGCCGCTGACCGCGCGCCTGCTGCGCGACACCGGCCTCAACTACACGCACCTGCACGTGGAGACGCCCCGCAACTACAAGCTGCGCGGAGACGCCCGCGACCCACGCATCCCGCGGGGCACCATGCAGCGCAACCTGGCCCTGCGCTGGCTGCGCGAGACCTTCCCGCGCAACTCCAGCCAGCCTGGCGTGGTCTACTTCGCCGACGACGACAACACCTACAGCCTGGAGCTCTTCGAAGAGATGCGCAGCACCAGGAGGGTGTCCGTGTGGCCCGTCGCCTTCGTGGGTGGCCTGCGGTACGAGGCCCCACGGGTGAACGGGGCAGGGAAGGTGGTCGGCTGGAAGACGGTGTTTGACCCCCACCGGCCATTTGCAATAGACATGGCTGGATTTGCCGTCAACCTGCGGCTCATTCTGCAGCGAAGCCAGGCCTACTTCAAGCTGCGAGGTGTGAAGGGAGGCTACCAGGAAAGCAGCCTCCTTCGAGAACTTGTCACCCTCAACGACCTGGAGCCCAAGGCAGCCAACTGCACCAAGATCCTGGTGTGGCACACACGGACAGAGAAGCCAGTGCTGGTGAATGAGGGCAAGAAGGGCTTCACTGACCCCTCGGTGGAGATCTGA |
ORF Protein Sequence | MPKRRDILAIVLIVLPWTLLITVWHQSTLAPLLAVHKDEGSDPRRETPPGADPREYCTSDRDIVEVVRTEYVYTRPPPWSDTLPTIHVVTPTYSRPVQKAELTRMANTLLHVPNLHWLVVEDAPRRTPLTARLLRDTGLNYTHLHVETPRNYKLRGDARDPRIPRGTMQRNLALRWLRETFPRNSSQPGVVYFADDDNTYSLELFEEMRSTRRVSVWPVAFVGGLRYEAPRVNGAGKVVGWKTVFDPHRPFAIDMAGFAVNLRLILQRSQAYFKLRGVKGGYQESSLLRELVTLNDLEPKAANCTKILVWHTRTEKPVLVNEGKKGFTDPSVEI |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE0035-Ab | Anti-B3GA1/ B3GAT1/ CD57 functional antibody |
Target Antigen | GM-Tg-g-SE0035-Ag | B3GAT1 protein |
ORF Viral Vector | pGMLP004112 | Human B3GAT1 Lentivirus plasmid |
ORF Viral Vector | pGMPC004775 | Human B3GAT1 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | vGMLP004112 | Human B3GAT1 Lentivirus particle |
Target information
Target ID | GM-SE0035 |
Target Name | B3GAT1 |
Gene ID | 27087, 76898, 695293, 117108, 101096760, 489265, 541596, 100072914 |
Gene Symbol and Synonyms | 0710007K08Rik,B3GAT1,CD57,GlcAT-P,GLCATP,GLCUATP,Hnk-1,HNK1,LEU7,NK-1,NK1 |
Uniprot Accession | Q9P2W7 |
Uniprot Entry Name | B3GA1_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000109956 |
Target Classification | Not Available |
The protein encoded by this gene is a member of the glucuronyltransferase gene family. These enzymes exhibit strict acceptor specificity, recognizing nonreducing terminal sugars and their anomeric linkages. This gene product functions as the key enzyme in a glucuronyl transfer reaction during the biosynthesis of the carbohydrate epitope HNK-1 (human natural killer-1, also known as CD57 and LEU7). Alternate transcriptional splice variants have been characterized. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.