Human B3GAT1/CD57/GLCATP ORF/cDNA clone-Lentivirus plasmid (NM_054025)

Cat. No.: pGMLP004112
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human B3GAT1/CD57/GLCATP Lentiviral expression plasmid for B3GAT1 lentivirus packaging, B3GAT1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to B3GAT1/CD57 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $581.4
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP004112
Gene Name B3GAT1
Accession Number NM_054025
Gene ID 27087
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1005 bp
Gene Alias CD57,GLCATP,GLCUATP,HNK1,LEU7,NK-1,NK1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCCGAAGAGACGGGACATCCTAGCGATCGTCCTCATCGTGCTGCCCTGGACTCTGCTCATCACTGTCTGGCACCAGAGCACCCTCGCACCCCTGCTCGCGGTACATAAGGATGAGGGCAGTGACCCCCGACGCGAAACGCCGCCCGGCGCCGACCCCAGGGAGTACTGCACGTCTGACCGCGACATCGTGGAGGTGGTGCGCACCGAGTACGTGTACACGCGGCCCCCGCCATGGTCCGACACGCTGCCCACCATCCACGTGGTGACGCCCACCTACAGCCGCCCGGTGCAGAAGGCCGAGCTGACGCGCATGGCCAACACGCTGCTGCACGTGCCCAACCTCCACTGGCTGGTGGTGGAGGATGCGCCGCGCCGGACGCCGCTGACCGCGCGCCTGCTGCGCGACACCGGCCTCAACTACACGCACCTGCACGTGGAGACGCCCCGCAACTACAAGCTGCGCGGAGACGCCCGCGACCCACGCATCCCGCGGGGCACCATGCAGCGCAACCTGGCCCTGCGCTGGCTGCGCGAGACCTTCCCGCGCAACTCCAGCCAGCCTGGCGTGGTCTACTTCGCCGACGACGACAACACCTACAGCCTGGAGCTCTTCGAAGAGATGCGCAGCACCAGGAGGGTGTCCGTGTGGCCCGTCGCCTTCGTGGGTGGCCTGCGGTACGAGGCCCCACGGGTGAACGGGGCAGGGAAGGTGGTCGGCTGGAAGACGGTGTTTGACCCCCACCGGCCATTTGCAATAGACATGGCTGGATTTGCCGTCAACCTGCGGCTCATTCTGCAGCGAAGCCAGGCCTACTTCAAGCTGCGAGGTGTGAAGGGAGGCTACCAGGAAAGCAGCCTCCTTCGAGAACTTGTCACCCTCAACGACCTGGAGCCCAAGGCAGCCAACTGCACCAAGATCCTGGTGTGGCACACACGGACAGAGAAGCCAGTGCTGGTGAATGAGGGCAAGAAGGGCTTCACTGACCCCTCGGTGGAGATCTGA
ORF Protein Sequence MPKRRDILAIVLIVLPWTLLITVWHQSTLAPLLAVHKDEGSDPRRETPPGADPREYCTSDRDIVEVVRTEYVYTRPPPWSDTLPTIHVVTPTYSRPVQKAELTRMANTLLHVPNLHWLVVEDAPRRTPLTARLLRDTGLNYTHLHVETPRNYKLRGDARDPRIPRGTMQRNLALRWLRETFPRNSSQPGVVYFADDDNTYSLELFEEMRSTRRVSVWPVAFVGGLRYEAPRVNGAGKVVGWKTVFDPHRPFAIDMAGFAVNLRLILQRSQAYFKLRGVKGGYQESSLLRELVTLNDLEPKAANCTKILVWHTRTEKPVLVNEGKKGFTDPSVEI

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0035-Ab Anti-B3GA1/ B3GAT1/ CD57 functional antibody
    Target Antigen GM-Tg-g-SE0035-Ag B3GAT1 protein
    ORF Viral Vector pGMLP004112 Human B3GAT1 Lentivirus plasmid
    ORF Viral Vector pGMPC004775 Human B3GAT1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP004112 Human B3GAT1 Lentivirus particle


    Target information

    Target ID GM-SE0035
    Target Name B3GAT1
    Gene ID 27087, 76898, 695293, 117108, 101096760, 489265, 541596, 100072914
    Gene Symbol and Synonyms 0710007K08Rik,B3GAT1,CD57,GlcAT-P,GLCATP,GLCUATP,Hnk-1,HNK1,LEU7,NK-1,NK1
    Uniprot Accession Q9P2W7
    Uniprot Entry Name B3GA1_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000109956
    Target Classification Not Available

    The protein encoded by this gene is a member of the glucuronyltransferase gene family. These enzymes exhibit strict acceptor specificity, recognizing nonreducing terminal sugars and their anomeric linkages. This gene product functions as the key enzyme in a glucuronyl transfer reaction during the biosynthesis of the carbohydrate epitope HNK-1 (human natural killer-1, also known as CD57 and LEU7). Alternate transcriptional splice variants have been characterized. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.