Human RAB9A/RAB9 ORF/cDNA clone-Lentivirus plasmid (NM_001195328)
Pre-made Human RAB9A/RAB9 Lentiviral expression plasmid for RAB9A lentivirus packaging, RAB9A lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to RAB9A/RAB9 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP004170 | Human RAB9A Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP004170 |
Gene Name | RAB9A |
Accession Number | NM_001195328 |
Gene ID | 9367 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 606 bp |
Gene Alias | RAB9 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGCAGGAAAATCATCACTTTTTAAAGTAATTCTCCTTGGAGATGGTGGAGTTGGGAAGAGTTCACTTATGAACAGATATGTAACTAATAAGTTTGATACCCAGCTCTTCCATACAATAGGTGTGGAATTTTTAAATAAAGATTTGGAAGTGGATGGACATTTTGTTACCATGCAGATTTGGGACACGGCAGGTCAGGAGCGATTCCGAAGCCTGAGGACACCATTTTACAGAGGTTCTGACTGCTGCCTGCTTACTTTTAGTGTCGATGATTCACAAAGCTTCCAGAACTTAAGTAACTGGAAGAAAGAATTCATATATTATGCAGATGTGAAAGAGCCTGAGAGCTTTCCTTTTGTGATTCTGGGTAACAAGATTGACATAAGCGAACGGCAGGTGTCTACAGAAGAAGCCCAAGCTTGGTGCAGGGACAACGGCGACTATCCTTATTTTGAAACAAGTGCAAAAGATGCCACAAATGTGGCAGCAGCCTTTGAGGAAGCGGTTCGAAGAGTTCTTGCTACCGAGGATAGGTCAGATCATTTGATTCAGACAGACACAGTCAATCTTCACCGAAAGCCCAAGCCTAGCTCATCTTGCTGTTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T66350-Ab | Anti-RAB9A monoclonal antibody |
Target Antigen | GM-Tg-g-T66350-Ag | RAB9A protein |
ORF Viral Vector | pGMLP004170 | Human RAB9A Lentivirus plasmid |
ORF Viral Vector | vGMLP004170 | Human RAB9A Lentivirus particle |
Target information
Target ID | GM-T66350 |
Target Name | RAB9A |
Gene ID | 9367, 56382, 720906, 84589, 101089079, 403947, 511776, 100050487 |
Gene Symbol and Synonyms | 2410064E05Rik,RAB9,RAB9A,Sid6061p |
Uniprot Accession | P51151 |
Uniprot Entry Name | RAB9A_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000123595 |
Target Classification | Not Available |
Enables GDP binding activity; GTP binding activity; and GTPase activity. Involved in negative regulation by host of symbiont catalytic activity; positive regulation of exocytosis; and regulation of protein localization. Located in late endosome; lysosome; and phagocytic vesicle. [provided by Alliance of Genome Resources, Apr 2022]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.