Human PSMA2/HC3/MU ORF/cDNA clone-Lentivirus plasmid (NM_002787)

Cat. No.: pGMLP004331
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human PSMA2/HC3/MU Lentiviral expression plasmid for PSMA2 lentivirus packaging, PSMA2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to PSMA2/HC3 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $476.25
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP004331
Gene Name PSMA2
Accession Number NM_002787
Gene ID 5683
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 705 bp
Gene Alias HC3,MU,PMSA2,PSC2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCGGAGCGCGGGTACAGCTTTTCGCTGACTACATTCAGCCCGTCTGGTAAACTTGTCCAGATTGAATATGCTTTGGCTGCTGTAGCTGGAGGAGCCCCGTCCGTGGGAATTAAAGCTGCAAATGGTGTGGTATTAGCAACTGAGAAAAAACAGAAATCCATTCTGTATGATGAGCGAAGTGTACACAAAGTAGAACCAATTACCAAGCATATAGGTTTGGTGTACAGTGGCATGGGCCCCGATTACAGAGTGCTTGTGCACAGAGCTCGAAAACTAGCTCAACAATACTATCTTGTGTACCAAGAACCCATTCCTACAGCTCAGCTGGTACAGAGAGTAGCTTCTGTGATGCAAGAATATACTCAGTCAGGTGGTGTTCGTCCATTTGGAGTTTCTTTACTTATTTGTGGTTGGAATGAGGGACGACCATATTTATTTCAGTCAGATCCATCTGGAGCTTACTTTGCCTGGAAAGCTACAGCAATGGGAAAGAACTATGTGAATGGGAAGACTTTCCTTGAGAAAAGATATAATGAAGATCTGGAACTTGAAGATGCCATTCATACAGCCATCTTAACCCTAAAGGAAAGCTTTGAAGGGCAAATGACAGAGGATAACATAGAAGTTGGAATCTGCAATGAAGCTGGATTTAGGAGGCTTACTCCAACTGAAGTTAAGGATTACTTGGCTGCCATAGCATAA
ORF Protein Sequence MAERGYSFSLTTFSPSGKLVQIEYALAAVAGGAPSVGIKAANGVVLATEKKQKSILYDERSVHKVEPITKHIGLVYSGMGPDYRVLVHRARKLAQQYYLVYQEPIPTAQLVQRVASVMQEYTQSGGVRPFGVSLLICGWNEGRPYLFQSDPSGAYFAWKATAMGKNYVNGKTFLEKRYNEDLELEDAIHTAILTLKESFEGQMTEDNIEVGICNEAGFRRLTPTEVKDYLAAIA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-TA098-Ab Anti-PSMA2 monoclonal antibody
    Target Antigen GM-Tg-g-TA098-Ag PSMA2 protein
    ORF Viral Vector pGMLP004331 Human PSMA2 Lentivirus plasmid
    ORF Viral Vector vGMLP004331 Human PSMA2 Lentivirus particle


    Target information

    Target ID GM-TA098
    Target Name PSMA2
    Gene ID 5683, 19166, 701683, 29669, 101088226, 475870, 539141, 100064293
    Gene Symbol and Synonyms HC3,Lmpc3,MU,PMSA2,PSC2,PSMA2
    Uniprot Accession P25787
    Uniprot Entry Name PSA2_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000106588
    Target Classification Not Available

    The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the peptidase T1A family, that is a 20S core alpha subunit. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.