Human ANKRD22 ORF/cDNA clone-Lentivirus plasmid (NM_144590)

Cat. No.: pGMLP004332
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human ANKRD22/ Lentiviral expression plasmid for ANKRD22 lentivirus packaging, ANKRD22 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to ANKRD22/ products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $444
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP004332
Gene Name ANKRD22
Accession Number NM_144590
Gene ID 118932
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 576 bp
Gene Alias
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGGAATCCTATACTCTGAGCCCATCTGCCAAGCAGCCTATCAGAATGACTTTGGACAAGTGTGGCGGTGGGTGAAAGAAGACAGCAGCTATGCCAACGTTCAAGATGGCTTTAATGGAGACACGCCCCTGATCTGTGCTTGCAGGCGAGGGCATGTGAGAATCGTTTCCTTCCTTTTAAGAAGAAATGCTAATGTCAACCTCAAAAACCAGAAAGAGAGAACCTGCTTGCATTATGCTGTGAAGAAAAAATTTACCTTCATTGATTATCTACTAATTATCCTCTTAATGCCTGTTCTGCTTATTGGGTATTTCCTCATGGTATCAAAGACAAAGCAGAATGAGGCTCTTGTACGAATGCTACTTGATGCTGGCGTCGAAGTTAATGCTACAGATTGTTATGGCTGTACCGCATTACATTATGCCTGTGAAATGAAAAACCAGTCTCTTATCCCTCTGCTCTTGGAAGCCCGTGCAGACCCCACAATAAAGAATAAGCATGGTGAGAGCTCACTGGATATTGCACGGAGATTAAAATTTTCCCAGATTGAATTAATGCTAAGGAAAGCATTGTAA
ORF Protein Sequence MGILYSEPICQAAYQNDFGQVWRWVKEDSSYANVQDGFNGDTPLICACRRGHVRIVSFLLRRNANVNLKNQKERTCLHYAVKKKFTFIDYLLIILLMPVLLIGYFLMVSKTKQNEALVRMLLDAGVEVNATDCYGCTALHYACEMKNQSLIPLLLEARADPTIKNKHGESSLDIARRLKFSQIELMLRKAL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0335-Ab Anti-ANKRD22 monoclonal antibody
    Target Antigen GM-Tg-g-IP0335-Ag ANKRD22 protein
    ORF Viral Vector pGMLP004332 Human ANKRD22 Lentivirus plasmid
    ORF Viral Vector vGMLP004332 Human ANKRD22 Lentivirus particle


    Target information

    Target ID GM-IP0335
    Target Name ANKRD22
    Gene ID 118932, 52024, 694240, 294093, 101093047, 119866257, 504991, 100071652
    Gene Symbol and Synonyms 5430429D21Rik,ANKRD22,D19Ertd675e
    Uniprot Accession Q5VYY1
    Uniprot Entry Name ANR22_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000152766
    Target Classification Not Available



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.