Human UCN/UI/ UROC ORF/cDNA clone-Lentivirus plasmid (NM_003353)
Pre-made Human UCN/UI/ UROC Lentiviral expression plasmid for UCN lentivirus packaging, UCN lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to UCN/UI products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP004467 | Human UCN Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP004467 |
Gene Name | UCN |
Accession Number | NM_003353 |
Gene ID | 7349 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 375 bp |
Gene Alias | UI, UROC |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAGGCAGGCGGGACGCGCAGCGCTGCTGGCCGCGCTGCTGCTCCTGGTACAGCTGTGCCCTGGGAGCAGCCAGAGGAGCCCCGAGGCGGCCGGGGTCCAGGACCCGAGTCTGCGCTGGAGCCCCGGGGCACGGAACCAGGGTGGCGGGGCCCGCGCGCTCCTCTTGCTGCTGGCGGAGCGCTTCCCGCGCCGCGCGGGGCCCGGCCGATTGGGACTCGGGACGGCAGGCGAGCGGCCGCGGCGGGACAACCCTTCTCTGTCCATTGACCTCACCTTTCACCTGCTGCGGACCCTGCTGGAGCTGGCGCGGACGCAGAGCCAGCGGGAGCGCGCCGAGCAGAACCGCATCATATTCGACTCGGTGGGCAAGTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE1356-Ab | Anti-UCN1/ UCN/ UI functional antibody |
Target Antigen | GM-Tg-g-SE1356-Ag | UCN protein |
ORF Viral Vector | pGMLP004467 | Human UCN Lentivirus plasmid |
ORF Viral Vector | vGMLP004467 | Human UCN Lentivirus particle |
Target information
Target ID | GM-SE1356 |
Target Name | UCN |
Gene ID | 7349, 22226, 699942, 29151, 111556298, 611041, 518336, 100055320 |
Gene Symbol and Synonyms | Mpv17,UCN,UCN1,UI,UROC |
Uniprot Accession | P55089 |
Uniprot Entry Name | UCN1_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000163794 |
Target Classification | Not Available |
This gene encodes a member of the sauvagine/corticotropin-releasing factor/urotensin I family. The encoded preproprotein is proteolytically processed to generate the mature peptide, an endogenous ligand for both corticotropin-releasing factor receptor 1 and corticotropin-releasing factor receptor 2. In the brain this peptide may be responsible for the effects of stress on appetite. This peptide may also play a role in mood disorders, neurodegeneration, and skeletal system disorders. In spite of the gene family name similarity, the product of this gene has no sequence similarity to urotensin-2. [provided by RefSeq, Feb 2016]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.