Human UCN/UI/ UROC ORF/cDNA clone-Lentivirus plasmid (NM_003353)

Pre-made Human UCN/UI/ UROC Lentiviral expression plasmid for UCN lentivirus packaging, UCN lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to UCN/UI products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP004467 Human UCN Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP004467
Gene Name UCN
Accession Number NM_003353
Gene ID 7349
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 375 bp
Gene Alias UI, UROC
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAGGCAGGCGGGACGCGCAGCGCTGCTGGCCGCGCTGCTGCTCCTGGTACAGCTGTGCCCTGGGAGCAGCCAGAGGAGCCCCGAGGCGGCCGGGGTCCAGGACCCGAGTCTGCGCTGGAGCCCCGGGGCACGGAACCAGGGTGGCGGGGCCCGCGCGCTCCTCTTGCTGCTGGCGGAGCGCTTCCCGCGCCGCGCGGGGCCCGGCCGATTGGGACTCGGGACGGCAGGCGAGCGGCCGCGGCGGGACAACCCTTCTCTGTCCATTGACCTCACCTTTCACCTGCTGCGGACCCTGCTGGAGCTGGCGCGGACGCAGAGCCAGCGGGAGCGCGCCGAGCAGAACCGCATCATATTCGACTCGGTGGGCAAGTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1356-Ab Anti-UCN1/ UCN/ UI functional antibody
    Target Antigen GM-Tg-g-SE1356-Ag UCN protein
    ORF Viral Vector pGMLP004467 Human UCN Lentivirus plasmid
    ORF Viral Vector vGMLP004467 Human UCN Lentivirus particle


    Target information

    Target ID GM-SE1356
    Target Name UCN
    Gene ID 7349, 22226, 699942, 29151, 111556298, 611041, 518336, 100055320
    Gene Symbol and Synonyms Mpv17,UCN,UCN1,UI,UROC
    Uniprot Accession P55089
    Uniprot Entry Name UCN1_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000163794
    Target Classification Not Available

    This gene encodes a member of the sauvagine/corticotropin-releasing factor/urotensin I family. The encoded preproprotein is proteolytically processed to generate the mature peptide, an endogenous ligand for both corticotropin-releasing factor receptor 1 and corticotropin-releasing factor receptor 2. In the brain this peptide may be responsible for the effects of stress on appetite. This peptide may also play a role in mood disorders, neurodegeneration, and skeletal system disorders. In spite of the gene family name similarity, the product of this gene has no sequence similarity to urotensin-2. [provided by RefSeq, Feb 2016]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.