Human CBLN1 ORF/cDNA clone-Lentivirus plasmid (NM_004352)

Cat. No.: pGMLP004473
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human CBLN1/ Lentiviral expression plasmid for CBLN1 lentivirus packaging, CBLN1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to CBLN1/ products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $445.5
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP004473
Gene Name CBLN1
Accession Number NM_004352
Gene ID 869
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 582 bp
Gene Alias
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCTGGGCGTCCTGGAGCTGCTGCTGCTGGGGGCTGCGTGGCTGGCGGGCCCGGCCCGCGGGCAGAATGAGACGGAGCCCATCGTGCTGGAGGGCAAGTGCCTGGTGGTGTGCGACTCCAACCCCACGTCCGACCCCACGGGCACTGCCCTGGGCATCTCTGTGCGCTCTGGCAGCGCCAAGGTGGCTTTCTCTGCCATCAGGAGCACCAACCACGAGCCGTCCGAGATGAGTAATCGCACCATGATCATCTACTTCGACCAGGTACTAGTGAACATTGGGAACAACTTTGATTCAGAACGCAGCACTTTCATCGCCCCGCGCAAAGGGATCTACAGTTTTAACTTCCACGTGGTAAAAGTCTACAACAGACAAACCATACAGGTGAGCCTCATGCTAAACGGGTGGCCGGTGATTTCAGCCTTCGCTGGTGACCAGGACGTGACCCGGGAGGCCGCCAGCAACGGAGTCCTAATCCAAATGGAGAAAGGCGACCGAGCATACCTCAAGCTGGAGCGGGGAAACTTGATGGGGGGCTGGAAGTACTCGACCTTCTCCGGATTCCTGGTGTTTCCTCTCTGA
ORF Protein Sequence MLGVLELLLLGAAWLAGPARGQNETEPIVLEGKCLVVCDSNPTSDPTGTALGISVRSGSAKVAFSAIRSTNHEPSEMSNRTMIIYFDQVLVNIGNNFDSERSTFIAPRKGIYSFNFHVVKVYNRQTIQVSLMLNGWPVISAFAGDQDVTREAASNGVLIQMEKGDRAYLKLERGNLMGGWKYSTFSGFLVFPL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0731-Ab Anti-CBLN1 functional antibody
    Target Antigen GM-Tg-g-SE0731-Ag CBLN1 protein
    ORF Viral Vector pGMLP004473 Human CBLN1 Lentivirus plasmid
    ORF Viral Vector vGMLP004473 Human CBLN1 Lentivirus particle


    Target information

    Target ID GM-SE0731
    Target Name CBLN1
    Gene ID 869, 12404, 693425, 498922, 101093481, 611712, 618604, 100050105
    Gene Symbol and Synonyms CBLN1
    Uniprot Accession P23435
    Uniprot Entry Name CBLN1_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000102924
    Target Classification Not Available

    This gene encodes a cerebellum-specific precursor protein, precerebellin, with similarity to the globular (non-collagen-like) domain of complement component C1qB. Precerebellin is processed to give rise to several derivatives, including the hexadecapeptide, cerebellin, which is highly enriched in postsynaptic structures of Purkinje cells. Cerebellin has also been found in human and rat adrenals, where it has been shown to enhance the secretory activity of this gland. [provided by RefSeq, Aug 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.