Human MAGEH1/APR-1/APR1 ORF/cDNA clone-Lentivirus plasmid (NM_014061)

Cat. No.: pGMLP004579
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human MAGEH1/APR-1/APR1 Lentiviral expression plasmid for MAGEH1 lentivirus packaging, MAGEH1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to MAGEH1/APR-1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $465
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP004579
Gene Name MAGEH1
Accession Number NM_014061
Gene ID 28986
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 660 bp
Gene Alias APR-1,APR1,MAGEH
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCCTCGGGGACGAAAGAGTCGGCGCCGCCGTAATGCGAGAGCCGCAGAAGAGAACCGCAACAATCGCAAAATCCAGGCCTCAGAGGCCTCCGAGACCCCTATGGCCGCCTCTGTGGTAGCGAGCACCCCCGAAGACGACCTGAGCGGCCCCGAGGAAGACCCGAGCACTCCAGAGGAGGCCTCTACCACCCCTGAAGAAGCCTCGAGCACTGCCCAAGCACAAAAGCCTTCAGTGCCCCGGAGCAATTTTCAGGGCACCAAGAAAAGTCTCCTGATGTCTATATTAGCGCTCATCTTCATCATGGGCAACAGCGCCAAGGAAGCTCTGGTCTGGAAAGTGCTGGGGAAGTTAGGAATGCAGCCTGGACGTCAGCACAGCATCTTTGGAGATCCGAAGAAGATCGTCACAGAAGAGTTTGTGCGCAGAGGGTACCTGATTTATAAACCGGTGCCCCGTAGCAGTCCGGTGGAGTATGAGTTCTTCTGGGGGCCCCGAGCACACGTGGAATCGAGCAAACTGAAAGTCATGCATTTTGTGGCAAGGGTTCGTAACCGATGCTCTAAAGACTGGCCTTGTAATTATGACTGGGATTCGGACGATGATGCAGAGGTTGAGGCTATCCTCAATTCAGGTGCTAGGGGTTATTCCGCCCCTTAA
ORF Protein Sequence MPRGRKSRRRRNARAAEENRNNRKIQASEASETPMAASVVASTPEDDLSGPEEDPSTPEEASTTPEEASSTAQAQKPSVPRSNFQGTKKSLLMSILALIFIMGNSAKEALVWKVLGKLGMQPGRQHSIFGDPKKIVTEEFVRRGYLIYKPVPRSSPVEYEFFWGPRAHVESSKLKVMHFVARVRNRCSKDWPCNYDWDSDDDAEVEAILNSGARGYSAP

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP1135-Ab Anti-MAGEH1 monoclonal antibody
    Target Antigen GM-Tg-g-IP1135-Ag MAGEH1 protein
    ORF Viral Vector pGMLP004579 Human MAGEH1 Lentivirus plasmid
    ORF Viral Vector vGMLP004579 Human MAGEH1 Lentivirus particle


    Target information

    Target ID GM-IP1135
    Target Name MAGEH1
    Gene ID 28986, 75625, 703812, 367767, 101096705, 514533, 100050717
    Gene Symbol and Synonyms 2010107K23Rik,APR-1,APR1,MAGEH,MAGEH1
    Uniprot Accession Q9H213
    Uniprot Entry Name MAGH1_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000187601
    Target Classification Not Available

    This gene belongs to the non-CT (non cancer/testis) subgroup of the melanoma-associated antigen (MAGE) superfamily. The encoded protein is likely associated with apoptosis, cell cycle arrest, growth inhibition or cell differentiation. The protein may be involved in the atRA (all-trans retinoic acid) signaling through the STAT1-alpha (signal transducer and activator of transcription 1-alpha) pathway. [provided by RefSeq, Aug 2013]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.