Human ORM1/AGP-A/AGP1 ORF/cDNA clone-Lentivirus plasmid (NM_000607)

Cat. No.: pGMLP004624
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human ORM1/AGP-A/AGP1 Lentiviral expression plasmid for ORM1 lentivirus packaging, ORM1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to ORM1/AGP-A products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $451.5
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP004624
Gene Name ORM1
Accession Number NM_000607
Gene ID 5004
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 606 bp
Gene Alias AGP-A,AGP1,HEL-S-153w,ORM
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCGCTGTCCTGGGTTCTTACAGTCCTGAGCCTCCTACCTCTGCTGGAAGCCCAGATCCCATTGTGTGCCAACCTAGTACCGGTGCCCATCACCAACGCCACCCTGGACCGGATCACTGGCAAGTGGTTTTATATCGCATCGGCCTTTCGAAACGAGGAGTACAATAAGTCGGTTCAGGAGATCCAAGCAACCTTCTTTTACTTCACCCCCAACAAGACAGAGGACACGATCTTTCTCAGAGAGTACCAGACCCGACAGGACCAGTGCATCTATAACACCACCTACCTGAATGTCCAGCGGGAAAATGGGACCATCTCCAGATACGTGGGAGGCCAAGAGCATTTCGCTCACTTGCTGATCCTCAGGGACACCAAGACCTACATGCTTGCTTTTGACGTGAACGATGAGAAGAACTGGGGGCTGTCTGTCTATGCTGACAAGCCAGAGACGACCAAGGAGCAACTGGGAGAGTTCTACGAAGCTCTCGACTGCTTGCGCATTCCCAAGTCAGATGTCGTGTACACCGATTGGAAAAAGGATAAGTGTGAGCCACTGGAGAAGCAGCACGAGAAGGAGAGGAAACAGGAGGAGGGGGAATCCTAG
ORF Protein Sequence MALSWVLTVLSLLPLLEAQIPLCANLVPVPITNATLDRITGKWFYIASAFRNEEYNKSVQEIQATFFYFTPNKTEDTIFLREYQTRQDQCIYNTTYLNVQRENGTISRYVGGQEHFAHLLILRDTKTYMLAFDVNDEKNWGLSVYADKPETTKEQLGEFYEALDCLRIPKSDVVYTDWKKDKCEPLEKQHEKERKQEEGES

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0389-Ab Anti-A1AG1/ ORM1/ AGP-A functional antibody
    Target Antigen GM-Tg-g-SE0389-Ag ORM1 protein
    ORF Viral Vector pGMLP004624 Human ORM1 Lentivirus plasmid
    ORF Viral Vector vGMLP004624 Human ORM1 Lentivirus particle


    Target information

    Target ID GM-SE0389
    Target Name ORM1
    Gene ID 5004, 18405, 703984, 24614
    Gene Symbol and Synonyms A1AG1,AAG,AGP,Agp-1,Agp-2,AGP-A,AGP1,Agpa1,HEL-S-153w,OMD,ORM,Orm-1,ORM1
    Uniprot Accession P02763
    Uniprot Entry Name A1AG1_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Prostate Cancer, Type 1 diabetes mellitus, Acute appendicitis, Acute kidney failure, Diabetic Nephropathy, Vasculitis
    Gene Ensembl ENSG00000229314
    Target Classification Not Available

    This gene encodes a key acute phase plasma protein.  Because of its increase due to acute inflammation, this protein is classified as an acute-phase reactant.  The specific function of this protein has not yet been determined; however, it may be involved in aspects of immunosuppression. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.