Human C5orf15/HTGN29/KCT2 ORF/cDNA clone-Lentivirus plasmid (NM_020199)

Cat. No.: pGMLP004643
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human C5orf15/HTGN29/KCT2 Lentiviral expression plasmid for C5orf15 lentivirus packaging, C5orf15 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to C5orf15/HTGN29 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $499.5
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP004643
Gene Name C5orf15
Accession Number NM_020199
Gene ID 56951
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 798 bp
Gene Alias HTGN29,KCT2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCCGCTGCCGTCCCGAAGAGGATGAGGGGGCCAGCACAAGCGAAACTGCTGCCCGGGTCGGCCATCCAAGCCCTTGTGGGGTTGGCGCGGCCGCTGGTCTTGGCGCTCCTGCTTGTGTCCGCCGCTCTATCCAGTGTTGTATCACGGACTGATTCACCGAGCCCAACCGTACTCAACTCACATATTTCTACCCCAAATGTGAATGCTTTAACACATGAAAACCAAACCAAACCTTCTATTTCCCAAATCAGCACCACCCTCCCTCCCACGACGAGTACCAAGAAAAGTGGAGGAGCATCTGTGGTCCCTCATCCCTCGCCTACTCCTCTGTCTCAAGAGGAAGCTGATAACAATGAAGATCCTAGTATAGAGGAGGAGGATCTTCTCATGCTGAACAGTTCTCCATCCACAGCCAAAGACACTCTAGACAATGGCGATTATGGAGAACCAGACTATGACTGGACCACGGGCCCCAGGGACGACGACGAGTCTGATGACACCTTGGAAGAAAACAGGGGTTACATGGAAATTGAACAGTCAGTGAAATCTTTTAAGATGCCATCCTCAAATATAGAAGAGGAAGACAGCCATTTCTTTTTTCATCTTATTATTTTTGCTTTTTGCATTGCTGTTGTTTACATTACATATCACAACAAAAGGAAGATTTTTCTTCTGGTTCAAAGCAGGAAATGGCGTGATGGCCTTTGTTCCAAAACAGTGGAATACCATCGCCTAGATCAGAATGTTAATGAGGCAATGCCTTCTTTGAAGATTACCAATGATTATATTTTTTAA
ORF Protein Sequence MAAAVPKRMRGPAQAKLLPGSAIQALVGLARPLVLALLLVSAALSSVVSRTDSPSPTVLNSHISTPNVNALTHENQTKPSISQISTTLPPTTSTKKSGGASVVPHPSPTPLSQEEADNNEDPSIEEEDLLMLNSSPSTAKDTLDNGDYGEPDYDWTTGPRDDDESDDTLEENRGYMEIEQSVKSFKMPSSNIEEEDSHFFFHLIIFAFCIAVVYITYHNKRKIFLLVQSRKWRDGLCSKTVEYHRLDQNVNEAMPSLKITNDYIF

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0477-Ab Anti-C5orf15 monoclonal antibody
    Target Antigen GM-Tg-g-IP0477-Ag C5orf15 protein
    ORF Viral Vector pGMLP004643 Human C5orf15 Lentivirus plasmid
    ORF Viral Vector vGMLP004643 Human C5orf15 Lentivirus particle


    Target information

    Target ID GM-IP0477
    Target Name C5orf15
    Gene ID 56951, 213673, 709969, 303122, 101098279, 100682619, 514781, 100072795
    Gene Symbol and Synonyms 9530068E07Rik,C10h5orf15,C11H5orf15,C14H5orf15,C5orf15,C6H5orf15,C7H5orf15,CA1H5orf15,HTGN29,KCT2,RGD1310352
    Uniprot Accession Q8NC54
    Uniprot Entry Name KCT2_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000113583
    Target Classification Not Available

    Predicted to be integral component of membrane. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.