Human PLD6/ZUC ORF/cDNA clone-Lentivirus plasmid (NM_178836)

Cat. No.: pGMLP004650
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human PLD6/ZUC Lentiviral expression plasmid for PLD6 lentivirus packaging, PLD6 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to PLD6/ZUC products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $489.75
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP004650
Gene Name PLD6
Accession Number NM_178836
Gene ID 201164
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 759 bp
Gene Alias ZUC
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGGACGGTTGAGTTGGCAGGTGGCGGCCGCGGCGGCTGTGGGCCTGGCTCTGACTCTGGAGGCGCTGCCTTGGGTGCTGCGCTGGCTGCGGTCCAGGCGGCGGCGGCCGCGGCGCGAGGCGCTGTTCTTCCCGTCTCAGGTGACCTGTACCGAGGCCCTGCTGCGGGCTCCGGGCGCGGAGCTGGCCGAGCTCCCCGAGGGCTGCCCGTGCGGCCTGCCCCACGGCGAGAGCGCGCTAAGCCGCCTGCTGCGTGCCCTGCTGGCCGCCCGCGCCAGCCTGGATCTCTGCCTGTTCGCCTTCTCCAGCCCGCAGCTGGGCCGCGCCGTGCAGTTGCTGCACCAGCGTGGGGTGCGAGTGCGGGTCGTCACCGACTGCGACTACATGGCCCTCAACGGCTCGCAAATCGGTCTGCTGCGCAAGGCAGGGATCCAGGTCCGGCACGATCAAGACCCAGGCTACATGCATCACAAGTTTGCCATCGTGGACAAGAGGGTGCTCATCACTGGCTCGCTCAACTGGACCACGCAAGCCATCCAGAACAACAGGGAGAATGTTCTCATCACGGAGGACGACGAGTACGTGCGGCTTTTTCTGGAAGAATTTGAGCGCATCTGGGAACAGTTTAACCCTACAAAGTATACCTTTTTCCCACCAAAGAAAAGTCACGGAAGCTGTGCCCCACCTGTCTCCAGAGCTGGAGGGAGATTGCTTTCATGGCACAGAACTTGCGGCACCTCCAGCGAAAGCCAAACCTAA
ORF Protein Sequence MGRLSWQVAAAAAVGLALTLEALPWVLRWLRSRRRRPRREALFFPSQVTCTEALLRAPGAELAELPEGCPCGLPHGESALSRLLRALLAARASLDLCLFAFSSPQLGRAVQLLHQRGVRVRVVTDCDYMALNGSQIGLLRKAGIQVRHDQDPGYMHHKFAIVDKRVLITGSLNWTTQAIQNNRENVLITEDDEYVRLFLEEFERIWEQFNPTKYTFFPPKKSHGSCAPPVSRAGGRLLSWHRTCGTSSESQT

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP1411-Ab Anti-PLD6 monoclonal antibody
    Target Antigen GM-Tg-g-IP1411-Ag PLD6 protein
    ORF Viral Vector pGMLP004650 Human PLD6 Lentivirus plasmid
    ORF Viral Vector vGMLP004650 Human PLD6 Lentivirus particle


    Target information

    Target ID GM-IP1411
    Target Name PLD6
    Gene ID 201164, 194908, 703931, 287366, 101088529, 489545, 526651, 100052895
    Gene Symbol and Synonyms 4933433K01Rik,Gm10,mitoPLD,mZuc,PLD6,RGD1311987,ZUC
    Uniprot Accession Q8N2A8
    Uniprot Entry Name PLD6_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000179598
    Target Classification Not Available

    Enables cardiolipin hydrolase activity and protein homodimerization activity. Involved in mitochondrial fusion. Acts upstream of or within positive regulation of mitochondrial fusion. Located in mitochondrial outer membrane. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.