Human PXDC1/C6orf145 ORF/cDNA clone-Lentivirus plasmid (NM_183373)

Cat. No.: pGMLP004656
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human PXDC1/C6orf145 Lentiviral expression plasmid for PXDC1 lentivirus packaging, PXDC1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to PXDC1/C6orf145 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $474
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP004656
Gene Name PXDC1
Accession Number NM_183373
Gene ID 221749
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 696 bp
Gene Alias C6orf145
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCCTCGGCGGTGTTTGAGGGCACGTCGCTCGTGAACATGTTCGTGCGCGGCTGCTGGGTGAACGGCATCCGCAGGCTCATCGTCAGCCGGCGCGGCGACGAAGAGGAGTTCTTCGAGATCCGCACGGAGTGGTCGGACCGCAGCGTGCTCTACCTGCACCGCAGCCTGGCGGACCTGGGCCGCCTGTGGCAGCGCCTGCGCGACGCCTTTCCCGAGGACCGGTCCGAACTGGCGCAGGGGCCGCTGCGGCAAGGACTGGTTGCCATAAAGGAAGCCCACGACATAGAGACCAGGCTTAATGAGGTGGAGAAGCTGCTGAAGACGATCATAAGCATGCCCTGTAAATATTCTAGATCGGAAGTTGTGCTCACCTTCTTCGAAAGATCTCCTCTGGATCAGGTGTTAAAAAATGATAATGTGCATAAAATTCAACCCAGCTTTCAAAGTCCAGTCAAAATATCAGAAATCATGAGGTCCAATGGATTTTGTTTAGCAAATACCGAAACAATAGTTATTGACCACAGTATACCAAATGGAAGAGACCAGCAGCTGGGCGTGGACCCAACAGAGCATTTATTTGAGAATGGCAGTGAGTTTCCCTCAGAGCTGGAGGACGGGGACGACCCAGCAGCCTACGTCACCAACCTGTCATATTACCACCTGGTCCCCTTCGAGACAGACATTTGGGACTGA
ORF Protein Sequence MASAVFEGTSLVNMFVRGCWVNGIRRLIVSRRGDEEEFFEIRTEWSDRSVLYLHRSLADLGRLWQRLRDAFPEDRSELAQGPLRQGLVAIKEAHDIETRLNEVEKLLKTIISMPCKYSRSEVVLTFFERSPLDQVLKNDNVHKIQPSFQSPVKISEIMRSNGFCLANTETIVIDHSIPNGRDQQLGVDPTEHLFENGSEFPSELEDGDDPAAYVTNLSYYHLVPFETDIWD

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP2684-Ab Anti-PXDC1 monoclonal antibody
    Target Antigen GM-Tg-g-IP2684-Ag PXDC1 protein
    ORF Viral Vector pGMLP004656 Human PXDC1 Lentivirus plasmid
    ORF Viral Vector vGMLP004656 Human PXDC1 Lentivirus particle


    Target information

    Target ID GM-IP2684
    Target Name PXDC1
    Gene ID 221749, 66895, 722937, 361238, 101084361, 608512, 613986, 100058493
    Gene Symbol and Synonyms 1300014I06Rik,C23H6orf145,C35H6orf145,C6orf145,PXDC1,RGD1311307
    Uniprot Accession Q5TGL8
    Uniprot Entry Name PXDC1_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000168994
    Target Classification Not Available

    Predicted to enable phosphatidylinositol binding activity. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.