Human C1QL1/C1QRF/C1QTNF14 ORF/cDNA clone-Lentivirus plasmid (NM_006688)

Cat. No.: pGMLP004658
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human C1QL1/C1QRF/C1QTNF14 Lentiviral expression plasmid for C1QL1 lentivirus packaging, C1QL1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to C1QL1/C1QRF products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $494.25
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP004658
Gene Name C1QL1
Accession Number NM_006688
Gene ID 10882
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 777 bp
Gene Alias C1QRF,C1QTNF14,CRF
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCTGCTGGTGCTGGTGGTGCTCATCCCCGTGCTGGTGAGCTCGGGCGGCCCGGAAGGCCACTATGAGATGCTGGGCACCTGCCGCATGGTGTGCGACCCCTACCCCGCGCGGGGCCCCGGCGCCGGCGCGCGGACCGACGGCGGCGACGCCCTGAGCGAGCAGAGCGGCGCGCCCCCGCCTTCCACGCTGGTGCAGGGCCCCCAGGGGAAGCCGGGCCGCACCGGCAAGCCCGGCCCTCCGGGGCCTCCCGGGGACCCAGGTCCTCCCGGCCCTGTGGGGCCGCCGGGGGAGAAGGGTGAGCCAGGCAAGCCGGGCCCTCCGGGGCTGCCGGGCGCGGGGGGCAGCGGCGCCATCAGCACTGCCACCTACACCACGGTGCCGCGCGTGGCCTTCTACGCCGGCCTCAAGAACCCCCACGAGGGTTACGAGGTACTCAAGTTTGACGACGTGGTCACCAACCTAGGCAACAACTACGACGCGGCCAGCGGCAAGTTTACGTGCAACATTCCCGGCACCTACTTTTTCACCTACCATGTCCTCATGCGCGGCGGCGACGGCACCAGTATGTGGGCAGACCTCTGCAAGAATGGCCAGGTGCGGGCCAGTGCTATTGCCCAGGACGCGGACCAGAACTACGACTACGCCAGCAACAGCGTGATCCTGCACCTGGACGCCGGCGACGAGGTCTTCATCAAGCTGGATGGAGGCAAAGCACACGGCGGCAACAGCAACAAATACAGCACGTTCTCTGGCTTCATCATCTACTCCGACTGA
ORF Protein Sequence MLLVLVVLIPVLVSSGGPEGHYEMLGTCRMVCDPYPARGPGAGARTDGGDALSEQSGAPPPSTLVQGPQGKPGRTGKPGPPGPPGDPGPPGPVGPPGEKGEPGKPGPPGLPGAGGSGAISTATYTTVPRVAFYAGLKNPHEGYEVLKFDDVVTNLGNNYDAASGKFTCNIPGTYFFTYHVLMRGGDGTSMWADLCKNGQVRASAIAQDADQNYDYASNSVILHLDAGDEVFIKLDGGKAHGGNSNKYSTFSGFIIYSD

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0708-Ab Anti-C1QRF/ C1QL1/ C1QTNF14 functional antibody
    Target Antigen GM-Tg-g-SE0708-Ag C1QL1 protein
    ORF Viral Vector pGMLP004658 Human C1QL1 Lentivirus plasmid
    ORF Viral Vector vGMLP004658 Human C1QL1 Lentivirus particle


    Target information

    Target ID GM-SE0708
    Target Name C1QL1
    Gene ID 10882, 23829, 715801, 363686, 101086269, 490931, 519675, 100064250
    Gene Symbol and Synonyms Adil,C1QL1,C1QRF,C1QTNF14,CRF,CTRP14,gliacolin
    Uniprot Accession O75973
    Uniprot Entry Name C1QRF_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000131094
    Target Classification Not Available

    Predicted to enable signaling receptor binding activity. Predicted to act upstream of or within maintenance of synapse structure; motor learning; and neuron remodeling. Predicted to be located in several cellular components, including climbing fiber; presynapse; and synaptic cleft. Predicted to be part of collagen trimer. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.