Human NINJ2 ORF/cDNA clone-Lentivirus plasmid (NM_016533)

Cat. No.: pGMLP004694
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human NINJ2/ Lentiviral expression plasmid for NINJ2 lentivirus packaging, NINJ2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to NINJ2/ products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $441.75
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP004694
Gene Name NINJ2
Accession Number NM_016533
Gene ID 4815
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 567 bp
Gene Alias
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGAATCAGCAAGAGAAAACATCGACCTTCAACCTGGAAGCTCCGACCCCAGGAGCCAGCCCATCAACCTGAACCATTACGCCACCAAGAAGAGCGTGGCGGAGAGCATGCTGGACGTGGCCCTGTTCATGTCCAACGCCATGCGGCTGAAGGCGGTGCTGGAGCAGGGACCATCCTCTCACTACTACACCACCCTGGTCACCCTCATCAGCCTCTCTCTGCTCCTGCAGGTGGTCATCGGTGTCCTGCTCGTGGTCATTGCACGGCTGAACCTGAATGAGGTAGAAAAGCAGTGGCGACTCAACCAGCTCAACAACGCAGCCACCATCTTGGTCTTCTTCACTGTGGTCATCAATGTTTTCATTACAGCCTTCGGGGCACATAAAACAGGGTTCCTGGCTGCCAGGGCCTCAAGGAATCCTCTCTGA
ORF Protein Sequence MESARENIDLQPGSSDPRSQPINLNHYATKKSVAESMLDVALFMSNAMRLKAVLEQGPSSHYYTTLVTLISLSLLLQVVIGVLLVVIARLNLNEVEKQWRLNQLNNAATILVFFTVVINVFITAFGAHKTGFLAARASRNPL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP1267-Ab Anti-NINJ2 monoclonal antibody
    Target Antigen GM-Tg-g-IP1267-Ag NINJ2 protein
    ORF Viral Vector pGMLP004694 Human NINJ2 Lentivirus plasmid
    ORF Viral Vector vGMLP004694 Human NINJ2 Lentivirus particle


    Target information

    Target ID GM-IP1267
    Target Name NINJ2
    Gene ID 4815, 29862, 706368, 59115, 101097073, 611886, 509556, 100056783
    Gene Symbol and Synonyms NINJ2
    Uniprot Accession Q9NZG7
    Uniprot Entry Name NINJ2_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000171840
    Target Classification Not Available

    The protein encoded by this gene belongs to the ninjurin (for nerve injury induced) family. It is a cell surface adhesion protein that is upregulated in Schwann cells surrounding the distal segment of injured nerve, and promotes neurite outgrowth, thus may have a role in nerve regeneration after nerve injury. [provided by RefSeq, Oct 2011]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.