Human VGLL4/VGL-4 ORF/cDNA clone-Lentivirus plasmid (NM_001284390.1)

Cat. No.: pGMLP004741
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human VGLL4/VGL-4 Lentiviral expression plasmid for VGLL4 lentivirus packaging, VGLL4 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to VGLL4/VGL-4 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $522
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP004741
Gene Name VGLL4
Accession Number NM_001284390.1
Gene ID 9686
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 888 bp
Gene Alias VGL-4
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGACTGAGAATACGCATTTTGACAAAATCCCTGAGTCCTGTGCACTCAAAAGTTGGAGACATCCAGGTCTGCACCATGGCGAAGCTGCTCTCAGGGGAGAACCCAGAATACAGACCCTGCCGGTGGCCTCTGCCCTCAGCAGTCACCGCACCGGCCCTCCCCCAATCAGCCCCAGCAAGAGGAAGTTCAGCATGGAGCCAGGTGACGAGGACCTAGACTGTGACAACGACCACGTCTCCAAAATGAGTCGCATCTTCAACCCCCATCTGAACAAGACTGCCAATGGAGACTGCCGCAGAGACCCCCGGGAGCGGAGCCGCAGCCCCATCGAGCGCGCTGTGGCCCCCACCATGAGCCTGCACGGCAGCCACCTGTACACCTCCCTCCCCAGCCTTGGCCTGGAGCAGCCCCTCGCACTGACCAAGAACAGCCTGGACGCCAGCAGGCCAGCCGGCCTCTCGCCCACACTGACCCCGGGGGAGCGGCAGCAGAACCGGCCCTCCGTGATCACCTGTGCCTCGGCTGGCGCCCGCAACTGCAACCTCTCGCACTGCCCCATCGCGCACAGCGGCTGTGCCGCGCCCGGGCCTGCCAGCTACCGGAGGCCACCGAGCGCTGCCACCACCTGTGACCCCGTGGTGGAGGAGCATTTCCGCAGGAGCCTGGGCAAGAATTACAAGGAGCCCGAGCCGGCACCCAACTCCGTGTCCATCACGGGCTCCGTGGACGACCACTTTGCCAAAGCTCTGGGTGACACGTGGCTCCAGATCAAAGCGGCCAAGGACGGAGCATCCAGCAGCCCTGAGTCCGCCTCTCGCAGGGGCCAGCCCGCCAGCCCCTCTGCCCACATGGTCAGCCACAGTCACTCCCCCTCTGTGGTCTCCTGA
ORF Protein Sequence MTENTHFDKIPESCALKSWRHPGLHHGEAALRGEPRIQTLPVASALSSHRTGPPPISPSKRKFSMEPGDEDLDCDNDHVSKMSRIFNPHLNKTANGDCRRDPRERSRSPIERAVAPTMSLHGSHLYTSLPSLGLEQPLALTKNSLDASRPAGLSPTLTPGERQQNRPSVITCASAGARNCNLSHCPIAHSGCAAPGPASYRRPPSAATTCDPVVEEHFRRSLGKNYKEPEPAPNSVSITGSVDDHFAKALGDTWLQIKAAKDGASSSPESASRRGQPASPSAHMVSHSHSPSVVS

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IO151-Ab Anti-VGLL4 monoclonal antibody
    Target Antigen GM-Tg-g-IO151-Ag VGLL4 protein
    ORF Viral Vector pGMLP004741 Human VGLL4 Lentivirus plasmid
    ORF Viral Vector vGMLP004741 Human VGLL4 Lentivirus particle


    Target information

    Target ID GM-IO151
    Target Name VGLL4
    Gene ID 9686, 232334, 699034, 297523, 101093673, 607588, 613904, 100051473
    Gene Symbol and Synonyms VGL-4,VGLL4
    Uniprot Accession Q14135
    Uniprot Entry Name VGLL4_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target, Immuno-oncology Target
    Disease Not Available
    Gene Ensembl ENSG00000144560
    Target Classification Checkpoint-Immuno Oncology

    Predicted to enable transcription coactivator binding activity. Involved in negative regulation of Wnt signaling pathway; negative regulation of cell growth; and negative regulation of hippo signaling. Predicted to be located in nucleus. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.