Human PGC/PEPC/PGII ORF/cDNA clone-Lentivirus plasmid (NM_001166424)

Cat. No.: pGMLP004753
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human PGC/PEPC/PGII Lentiviral expression plasmid for PGC lentivirus packaging, PGC lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to PGC/PEPC products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $537
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP004753
Gene Name PGC
Accession Number NM_001166424
Gene ID 5225
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 948 bp
Gene Alias PEPC,PGII
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAAGTGGATGGTGGTGGTCTTGGTCTGCCTCCAGCTCTTGGAGGCAGCAGTGGTCAAAGTGCCCCTGAAGAAATTTAAGTCTATCCGTGAGACCATGAAGGAGAAGGGCTTGCTGGGGGAGTTCCTGAGGACCCACAAGTATGATCCTGCTTGGAAGTACCGCTTTGGTGACCTCAGCGTGACCTACGAGCCCATGGCCTACATGGATGCTGCCTACTTTGGTGAGATCAGCATCGGGACTCCACCCCAGAACTTCCTGGTCCTTTTTGACACCGGCTCCTCCAACTTGTGGGTGCCCTCTGTCTACTGCCAGAGCCAGGCCTGCACCAGTCACTCCCGCTTCAACCCCAGCGAGTCGTCCACCTACTCCACCAATGGGCAGACCTTCTCCCTGCAGTATGGCAGTGGCAGCCTCACCGGCTTCTTTGGCTATGACACCCTGACTGTCCAGAGCATCCAGGTCCCCAACCAGGAGTTCGGCTTGAGTGAGAATGAGCCTGGTACCAACTTCGTCTATGCGCAGTTTGATGGCATCATGGGCCTGGCCTACCCTGCTCTGTCCGTGGATGAGGCCACCACAGCTATGCAGGGCATGGTGCAGGAGGGCGCCCTCACCAGCCCCGTCTTCAGCGTCTACCTCAGCAACCTGGTCCTGGAGTCTTCTGGTCTAGGTCCACTGCTGACCCCTAGCAGAGCAGCTCCACCCAGCTCCACACTCCAGCTACCAGAGAAGCCTCTGGAACAAACATGGAATATCCTTACCCCCTTCACCAAGACCCTACCTGTCTCCAATCTCAGCAGAAAAGTAACAAGCTGGGCCGGGGTGGGGATCCCGGTGACATGTCTACCAGAGGCAGGAAGCGGAGGGGAGAGGAGAGCAGAGTGTGGGCTGGGGGTCCCAACCACTAGGGGACCCCCCAGAAGTCAGCATCATTCGGGAGCCTGA
ORF Protein Sequence MKWMVVVLVCLQLLEAAVVKVPLKKFKSIRETMKEKGLLGEFLRTHKYDPAWKYRFGDLSVTYEPMAYMDAAYFGEISIGTPPQNFLVLFDTGSSNLWVPSVYCQSQACTSHSRFNPSESSTYSTNGQTFSLQYGSGSLTGFFGYDTLTVQSIQVPNQEFGLSENEPGTNFVYAQFDGIMGLAYPALSVDEATTAMQGMVQEGALTSPVFSVYLSNLVLESSGLGPLLTPSRAAPPSSTLQLPEKPLEQTWNILTPFTKTLPVSNLSRKVTSWAGVGIPVTCLPEAGSGGERRAECGLGVPTTRGPPRSQHHSGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T45601-Ab Anti-PEPC/ PGC/ PGII functional antibody
    Target Antigen GM-Tg-g-T45601-Ag PGC protein
    ORF Viral Vector pGMLP004753 Human PGC Lentivirus plasmid
    ORF Viral Vector vGMLP004753 Human PGC Lentivirus particle


    Target information

    Target ID GM-T45601
    Target Name PGC
    Gene ID 5225, 109820, 695713, 24864, 101100053, 609052, 514502, 100066460
    Gene Symbol and Synonyms 2210410L06Rik,PEPC,Pg-1,PG1,PGC,PGII,Upg-1,Upg1
    Uniprot Accession P20142
    Uniprot Entry Name PEPC_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target
    Disease Prostate Cancer
    Gene Ensembl ENSG00000096088
    Target Classification Not Available

    This gene encodes an aspartic proteinase that belongs to the peptidase family A1. The encoded protein is a digestive enzyme that is produced in the stomach and constitutes a major component of the gastric mucosa. This protein is also secreted into the serum. This protein is synthesized as an inactive zymogen that includes a highly basic prosegment. This enzyme is converted into its active mature form at low pH by sequential cleavage of the prosegment that is carried out by the enzyme itself. Polymorphisms in this gene are associated with susceptibility to gastric cancers. Serum levels of this enzyme are used as a biomarker for certain gastric diseases including Helicobacter pylori related gastritis. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 1. [provided by RefSeq, Oct 2009]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.