Human FGF8/AIGF/ FGF-8 ORF/cDNA clone-Lentivirus plasmid (NM_033165)

Pre-made Human FGF8/AIGF/ FGF-8 Lentiviral expression plasmid for FGF8 lentivirus packaging, FGF8 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to FGF8/AIGF products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP004784 Human FGF8 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP004784
Gene Name FGF8
Accession Number NM_033165
Gene ID 2253
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 615 bp
Gene Alias AIGF, FGF-8, HBGF-8, HH6, KAL6
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGGCAGCCCCCGCTCCGCGCTGAGCTGCCTGCTGTTGCACTTGCTGGTCCTCTGCCTCCAAGCCCAGCATGTGAGGGAGCAGAGCCTGGTGACGGATCAGCTCAGCCGCCGCCTCATCCGGACCTACCAACTCTACAGCCGCACCAGCGGGAAGCACGTGCAGGTCCTGGCCAACAAGCGCATCAACGCCATGGCAGAGGACGGCGACCCCTTCGCAAAGCTCATCGTGGAGACGGACACCTTTGGAAGCAGAGTTCGAGTCCGAGGAGCCGAGACGGGCCTCTACATCTGCATGAACAAGAAGGGGAAGCTGATCGCCAAGAGCAACGGCAAAGGCAAGGACTGCGTCTTCACGGAGATTGTGCTGGAGAACAACTACACAGCGCTGCAGAATGCCAAGTACGAGGGCTGGTACATGGCCTTCACCCGCAAGGGCCGGCCCCGCAAGGGCTCCAAGACGCGGCAGCACCAGCGTGAGGTCCACTTCATGAAGCGGCTGCCCCGGGGCCACCACACCACCGAGCAGAGCCTGCGCTTCGAGTTCCTCAACTACCCGCCCTTCACGCGCAGCCTGCGCGGCAGCCAGAGGACTTGGGCCCCCGAGCCCCGATAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T69580-Ab Anti-FGF8/ AIGF/ FGF-8 functional antibody
    Target Antigen GM-Tg-g-T69580-Ag FGF8 protein
    Cytokine cks-Tg-g-GM-T69580 fibroblast growth factor 8 (FGF8) protein & antibody
    ORF Viral Vector pGMLP004784 Human FGF8 Lentivirus plasmid
    ORF Viral Vector vGMLP004784 Human FGF8 Lentivirus particle


    Target information

    Target ID GM-T69580
    Target Name FGF8
    Gene ID 2253, 14179, 722394, 29349, 101084652, 403868, 326284, 100060309
    Gene Symbol and Synonyms AIGF,FGF-8,Fgf6c,FGF8,HBGF-8,HH6,KAL6
    Uniprot Accession P55075
    Uniprot Entry Name FGF8_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Cytokine Target
    Disease Cancer
    Gene Ensembl ENSG00000107831
    Target Classification Tumor-associated antigen (TAA)

    The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. This protein is known to be a factor that supports androgen and anchorage independent growth of mammary tumor cells. Overexpression of this gene has been shown to increase tumor growth and angiogensis. The adult expression of this gene is restricted to testes and ovaries. Temporal and spatial pattern of this gene expression suggests its function as an embryonic epithelial factor. Studies of the mouse and chick homologs revealed roles in midbrain and limb development, organogenesis, embryo gastrulation and left-right axis determination. The alternative splicing of this gene results in four transcript variants. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.