Human FGF8/AIGF/ FGF-8 ORF/cDNA clone-Lentivirus plasmid (NM_033165)
Pre-made Human FGF8/AIGF/ FGF-8 Lentiviral expression plasmid for FGF8 lentivirus packaging, FGF8 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to FGF8/AIGF products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP004784 | Human FGF8 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP004784 |
Gene Name | FGF8 |
Accession Number | NM_033165 |
Gene ID | 2253 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 615 bp |
Gene Alias | AIGF, FGF-8, HBGF-8, HH6, KAL6 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGGCAGCCCCCGCTCCGCGCTGAGCTGCCTGCTGTTGCACTTGCTGGTCCTCTGCCTCCAAGCCCAGCATGTGAGGGAGCAGAGCCTGGTGACGGATCAGCTCAGCCGCCGCCTCATCCGGACCTACCAACTCTACAGCCGCACCAGCGGGAAGCACGTGCAGGTCCTGGCCAACAAGCGCATCAACGCCATGGCAGAGGACGGCGACCCCTTCGCAAAGCTCATCGTGGAGACGGACACCTTTGGAAGCAGAGTTCGAGTCCGAGGAGCCGAGACGGGCCTCTACATCTGCATGAACAAGAAGGGGAAGCTGATCGCCAAGAGCAACGGCAAAGGCAAGGACTGCGTCTTCACGGAGATTGTGCTGGAGAACAACTACACAGCGCTGCAGAATGCCAAGTACGAGGGCTGGTACATGGCCTTCACCCGCAAGGGCCGGCCCCGCAAGGGCTCCAAGACGCGGCAGCACCAGCGTGAGGTCCACTTCATGAAGCGGCTGCCCCGGGGCCACCACACCACCGAGCAGAGCCTGCGCTTCGAGTTCCTCAACTACCCGCCCTTCACGCGCAGCCTGCGCGGCAGCCAGAGGACTTGGGCCCCCGAGCCCCGATAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T69580-Ab | Anti-FGF8/ AIGF/ FGF-8 functional antibody |
Target Antigen | GM-Tg-g-T69580-Ag | FGF8 protein |
Cytokine | cks-Tg-g-GM-T69580 | fibroblast growth factor 8 (FGF8) protein & antibody |
ORF Viral Vector | pGMLP004784 | Human FGF8 Lentivirus plasmid |
ORF Viral Vector | vGMLP004784 | Human FGF8 Lentivirus particle |
Target information
Target ID | GM-T69580 |
Target Name | FGF8 |
Gene ID | 2253, 14179, 722394, 29349, 101084652, 403868, 326284, 100060309 |
Gene Symbol and Synonyms | AIGF,FGF-8,Fgf6c,FGF8,HBGF-8,HH6,KAL6 |
Uniprot Accession | P55075 |
Uniprot Entry Name | FGF8_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target, Cytokine Target |
Disease | Cancer |
Gene Ensembl | ENSG00000107831 |
Target Classification | Tumor-associated antigen (TAA) |
The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. This protein is known to be a factor that supports androgen and anchorage independent growth of mammary tumor cells. Overexpression of this gene has been shown to increase tumor growth and angiogensis. The adult expression of this gene is restricted to testes and ovaries. Temporal and spatial pattern of this gene expression suggests its function as an embryonic epithelial factor. Studies of the mouse and chick homologs revealed roles in midbrain and limb development, organogenesis, embryo gastrulation and left-right axis determination. The alternative splicing of this gene results in four transcript variants. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.