Human CNOT9/CAF40/ CT129 ORF/cDNA clone-Lentivirus plasmid (NM_005444)

Pre-made Human CNOT9/CAF40/ CT129 Lentiviral expression plasmid for CNOT9 lentivirus packaging, CNOT9 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to CNOT9/CAF40 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP004821 Human CNOT9 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP004821
Gene Name CNOT9
Accession Number NM_005444
Gene ID 9125
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 900 bp
Gene Alias CAF40, CT129, RCD-1, RCD1, RQCD1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCACAGCCTGGCGACGGCTGCGCCTGTGCCTACTACACTGGCACAAGTGGATAGAGAAAAGATCTATCAGTGGATCAATGAGCTGTCCAGTCCTGAGACTAGGGAAAATGCTTTGCTGGAGCTAAGTAAGAAGCGAGAATCTGTTCCTGACCTTGCACCCATGCTGTGGCATTCATTTGGTACTATTGCAGCACTTTTACAGGAAATTGTAAATATTTATCCATCTATCAACCCACCCACCTTGACAGCACACCAGTCTAACAGAGTTTGCAATGCTCTGGCATTACTGCAATGTGTAGCATCACATCCAGAAACCAGGTCAGCGTTTCTCGCAGCACACATCCCACTTTTTTTGTACCCCTTTTTGCACACTGTCAGCAAAACACGTCCCTTTGAGTATCTCCGGCTCACCAGCCTTGGAGTTATTGGGGCCCTGGTGAAAACAGATGAACAAGAAGTAATCAACTTTTTATTAACAACAGAAATTATCCCTTTATGTTTGCGAATTATGGAATCTGGAAGTGAACTTTCTAAAACAGTTGCCACATTCATCCTCCAGAAGATCTTGTTAGATGACACTGGTTTGGCTTATATATGTCAGACGTATGAGCGTTTCTCCCATGTTGCCATGATCTTGGGTAAGATGGTCCTGCAGCTATCCAAAGAGCCTTCTGCCCGTCTGCTGAAGCATGTAGTGAGATGTTACCTTCGACTTTCAGATAACCCCAGGGCACGTGAAGCACTCAGACAGTGCCTCCCTGACCAGCTGAAAGACACAACCTTCGCCCAGGTGCTAAAAGATGACACCACCACGAAACGCTGGCTTGCACAACTGGTGAAGAACCTGCAAGAGGGCCAGGTCACCGATCCCCGGGGTATCCCCCTGCCCCCTCAGTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1526-Ab Anti-CNOT9/ CAF40/ CT129 functional antibody
    Target Antigen GM-Tg-g-SE1526-Ag CNOT9 protein
    ORF Viral Vector pGMLP004821 Human CNOT9 Lentivirus plasmid
    ORF Viral Vector vGMLP004821 Human CNOT9 Lentivirus particle


    Target information

    Target ID GM-SE1526
    Target Name CNOT9
    Gene ID 9125, 58184, 701978, 301513, 101090202, 610449, 536537, 100058624
    Gene Symbol and Synonyms 2610007F23Rik,CAF40,CNOT9,CT129,Fl10,RCD-1,RCD1,RQCD1
    Uniprot Accession Q92600
    Uniprot Entry Name CNOT9_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000144580
    Target Classification Not Available

    This gene encodes a member of the highly conserved RCD1 protein family. The encoded protein is a transcriptional cofactor and a core protein of the CCR4-NOT complex. It may be involved in signal transduction as well as retinoic acid-regulated cell differentiation and development. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Oct 2012]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.