Human CNOT9/CAF40/CT129 ORF/cDNA clone-Lentivirus plasmid (NM_005444)
Cat. No.: pGMLP004821
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human CNOT9/CAF40/CT129 Lentiviral expression plasmid for CNOT9 lentivirus packaging, CNOT9 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
CNOT9/CAF40 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP004821 |
Gene Name | CNOT9 |
Accession Number | NM_005444 |
Gene ID | 9125 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 900 bp |
Gene Alias | CAF40,CT129,RCD-1,RCD1,RQCD1 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGCACAGCCTGGCGACGGCTGCGCCTGTGCCTACTACACTGGCACAAGTGGATAGAGAAAAGATCTATCAGTGGATCAATGAGCTGTCCAGTCCTGAGACTAGGGAAAATGCTTTGCTGGAGCTAAGTAAGAAGCGAGAATCTGTTCCTGACCTTGCACCCATGCTGTGGCATTCATTTGGTACTATTGCAGCACTTTTACAGGAAATTGTAAATATTTATCCATCTATCAACCCACCCACCTTGACAGCACACCAGTCTAACAGAGTTTGCAATGCTCTGGCATTACTGCAATGTGTAGCATCACATCCAGAAACCAGGTCAGCGTTTCTCGCAGCACACATCCCACTTTTTTTGTACCCCTTTTTGCACACTGTCAGCAAAACACGTCCCTTTGAGTATCTCCGGCTCACCAGCCTTGGAGTTATTGGGGCCCTGGTGAAAACAGATGAACAAGAAGTAATCAACTTTTTATTAACAACAGAAATTATCCCTTTATGTTTGCGAATTATGGAATCTGGAAGTGAACTTTCTAAAACAGTTGCCACATTCATCCTCCAGAAGATCTTGTTAGATGACACTGGTTTGGCTTATATATGTCAGACGTATGAGCGTTTCTCCCATGTTGCCATGATCTTGGGTAAGATGGTCCTGCAGCTATCCAAAGAGCCTTCTGCCCGTCTGCTGAAGCATGTAGTGAGATGTTACCTTCGACTTTCAGATAACCCCAGGGCACGTGAAGCACTCAGACAGTGCCTCCCTGACCAGCTGAAAGACACAACCTTCGCCCAGGTGCTAAAAGATGACACCACCACGAAACGCTGGCTTGCACAACTGGTGAAGAACCTGCAAGAGGGCCAGGTCACCGATCCCCGGGGTATCCCCCTGCCCCCTCAGTGA |
ORF Protein Sequence | MHSLATAAPVPTTLAQVDREKIYQWINELSSPETRENALLELSKKRESVPDLAPMLWHSFGTIAALLQEIVNIYPSINPPTLTAHQSNRVCNALALLQCVASHPETRSAFLAAHIPLFLYPFLHTVSKTRPFEYLRLTSLGVIGALVKTDEQEVINFLLTTEIIPLCLRIMESGSELSKTVATFILQKILLDDTGLAYICQTYERFSHVAMILGKMVLQLSKEPSARLLKHVVRCYLRLSDNPRAREALRQCLPDQLKDTTFAQVLKDDTTTKRWLAQLVKNLQEGQVTDPRGIPLPPQ |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE1526-Ab | Anti-CNOT9/ CAF40/ CT129 functional antibody |
Target Antigen | GM-Tg-g-SE1526-Ag | CNOT9 protein |
ORF Viral Vector | pGMLP004821 | Human CNOT9 Lentivirus plasmid |
ORF Viral Vector | vGMLP004821 | Human CNOT9 Lentivirus particle |
Target information
Target ID | GM-SE1526 |
Target Name | CNOT9 |
Gene ID | 9125, 58184, 701978, 301513, 101090202, 610449, 536537, 100058624 |
Gene Symbol and Synonyms | 2610007F23Rik,CAF40,CNOT9,CT129,Fl10,RCD-1,RCD1,RQCD1 |
Uniprot Accession | Q92600 |
Uniprot Entry Name | CNOT9_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000144580 |
Target Classification | Not Available |
This gene encodes a member of the highly conserved RCD1 protein family. The encoded protein is a transcriptional cofactor and a core protein of the CCR4-NOT complex. It may be involved in signal transduction as well as retinoic acid-regulated cell differentiation and development. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Oct 2012]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.