Human MXRA7 ORF/cDNA clone-Lentivirus plasmid (NM_001008528)

Cat. No.: pGMLP004841
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human MXRA7/ Lentiviral expression plasmid for MXRA7 lentivirus packaging, MXRA7 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to MXRA7/ products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $453.75
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP004841
Gene Name MXRA7
Accession Number NM_001008528
Gene ID 439921
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 615 bp
Gene Alias
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGAGGCGCCGGCCGAGCTACTGGCCGCGCTGCCTGCGCTGGCCACCGCGCTGGCCCTTCTGCTCGCCTGGCTACTGGTGCGGCGTGGGGCGGCCGCGAGCCCGGAGCCTGCCCGCGCGCCCCCGGAACCCGCGCCCCCGGCCGAGGCCACCGGGGCCCCGGCGCCGTCCCGCCCCTGCGCCCCCGAGCCGGCGGCCTCGCCCGCGGGGCCGGAGGAGCCTGGAGAGCCCGCGGGGCTGGGGGAGCTCGGGGAGCCTGCGGGACCGGGGGAGCCCGAAGGGCCAGGGGATCCCGCGGCGGCGCCAGCGGAGGCGGAGGAGCAGGCGGTGGAGGCGAGGCAGGAAGAGGAGCAGGACTTGGATGGTGAGAAGGGGCCATCATCGGAAGGGCCTGAGGAGGAGGACGGAGAAGGCTTCTCCTTCAAATACAGCCCCGGGAAGCTGAGGGGAAACCAGTACAAGAAGATGATGACCAAAGAGGAGCTGGAGGAGGAGCAGAGAGTTCAGAAGGAACAGCTGGCTGCCATCTTCAAGCTCATGAAAGACAACAAGGAGACGTTTGGCGAGATGTCCGACGGCGACGTGCAGGAGCAGCTCCGGCTCTACGACATGTAG
ORF Protein Sequence MEAPAELLAALPALATALALLLAWLLVRRGAAASPEPARAPPEPAPPAEATGAPAPSRPCAPEPAASPAGPEEPGEPAGLGELGEPAGPGEPEGPGDPAAAPAEAEEQAVEARQEEEQDLDGEKGPSSEGPEEEDGEGFSFKYSPGKLRGNQYKKMMTKEELEEEQRVQKEQLAAIFKLMKDNKETFGEMSDGDVQEQLRLYDM

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0359-Ab Anti-MXRA7 functional antibody
    Target Antigen GM-Tg-g-SE0359-Ag MXRA7 protein
    ORF Viral Vector pGMLP004841 Human MXRA7 Lentivirus plasmid
    ORF Viral Vector vGMLP004841 Human MXRA7 Lentivirus particle


    Target information

    Target ID GM-SE0359
    Target Name MXRA7
    Gene ID 439921, 67622, 106994140, 690599, 102902441, 119873394, 617087, 100058608
    Gene Symbol and Synonyms 1810057P16Rik,E130302J09Rik,MXRA7
    Uniprot Accession P84157
    Uniprot Entry Name MXRA7_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Prostate Cancer
    Gene Ensembl ENSG00000182534
    Target Classification Not Available

    Located in endoplasmic reticulum. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.