Human CTF1/CT-1/ CT1 ORF/cDNA clone-Lentivirus plasmid (NM_001142544)

Pre-made Human CTF1/CT-1/ CT1 Lentiviral expression plasmid for CTF1 lentivirus packaging, CTF1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to CTF1/CT-1 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP004846 Human CTF1 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP004846
Gene Name CTF1
Accession Number NM_001142544
Gene ID 1489
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 603 bp
Gene Alias CT-1, CT1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAGCCGGAGGGAGGGAAGTCTGGACCCCCAGACTGATTCCTCAGTCTCACTTCTTCCCCACTTGGAGGCCAAGATCCGTCAGACACACAGCCTTGCGCACCTCCTCACCAAATACGCTGAGCAGCTGCTCCAGGAATATGTGCAGCTCCAGGGAGACCCCTTCGGGCTGCCCAGCTTCTCGCCGCCGCGGCTGCCGGTGGCCGGCCTGAGCGCCCCGGCTCCGAGCCACGCGGGGCTGCCAGTGCACGAGCGGCTGCGGCTGGACGCGGCGGCGCTGGCCGCGCTGCCCCCGCTGCTGGACGCAGTGTGTCGCCGCCAGGCCGAGCTGAACCCGCGCGCGCCGCGCCTGCTGCGCCGCCTGGAGGACGCGGCGCGCCAGGCCCGGGCCCTGGGCGCCGCCGTGGAGGCCTTGCTGGCCGCGCTGGGCGCCGCCAACCGCGGGCCCCGGGCCGAGCCCCCCGCCGCCACCGCCTCAGCCGCCTCCGCCACCGGGGTCTTCCCCGCCAAGGTGCTGGGGCTCCGCGTTTGCGGCCTCTACCGCGAGTGGCTGAGCCGCACCGAGGGCGACCTGGGCCAGCTGCTGCCCGGGGGCTCGGCCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T94977-Ab Anti-CTF1/ CT-1/ CT1 functional antibody
    Target Antigen GM-Tg-g-T94977-Ag CTF1 protein
    Cytokine cks-Tg-g-GM-T94977 cardiotrophin 1 (CTF1) protein & antibody
    ORF Viral Vector pGMLV000332 Human CTF1 Lentivirus plasmid
    ORF Viral Vector pGMLP004846 Human CTF1 Lentivirus plasmid
    ORF Viral Vector vGMLV000332 Human CTF1 Lentivirus particle
    ORF Viral Vector vGMLP004846 Human CTF1 Lentivirus particle


    Target information

    Target ID GM-T94977
    Target Name CTF1
    Gene ID 1489, 13019, 713850, 29201, 403821, 514803
    Gene Symbol and Synonyms CT-1,CT1,CTF1
    Uniprot Accession Q16619
    Uniprot Entry Name CTF1_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Cytokine Target
    Disease Not Available
    Gene Ensembl ENSG00000150281
    Target Classification Not Available

    The protein encoded by this gene is a secreted cytokine that induces cardiac myocyte hypertrophy in vitro. It has been shown to bind and activate the ILST/gp130 receoptor. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.