Human MAGEA6/CT1.6/MAGE-3b ORF/cDNA clone-Lentivirus plasmid (NM_175868)

Cat. No.: pGMLP004870
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human MAGEA6/CT1.6/MAGE-3b Lentiviral expression plasmid for MAGEA6 lentivirus packaging, MAGEA6 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to MAGEA6/CT1.6 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $536.25
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP004870
Gene Name MAGEA6
Accession Number NM_175868
Gene ID 4105
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 945 bp
Gene Alias CT1.6,MAGE-3b,MAGE3B,MAGE6
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCCTCTTGAGCAGAGGAGTCAGCACTGCAAGCCTGAAGAAGGCCTTGAGGCCCGAGGAGAGGCCCTGGGCCTGGTGGGTGCGCAGGCTCCTGCTACTGAGGAGCAGGAGGCTGCCTCCTCCTCTTCTACTCTAGTTGAAGTCACCCTGGGGGAGGTGCCTGCTGCCGAGTCACCAGATCCTCCCCAGAGTCCTCAGGGAGCCTCCAGCCTCCCCACTACCATGAACTACCCTCTCTGGAGCCAATCCTATGAGGACTCCAGCAACCAAGAAGAGGAGGGGCCAAGCACCTTCCCTGACCTGGAGTCTGAGTTCCAAGCAGCACTCAGTAGGAAGGTGGCCAAGTTGGTTCATTTTCTGCTCCTCAAGTATCGAGCCAGGGAGCCGGTCACAAAGGCAGAAATGCTGGGGAGTGTCGTCGGAAATTGGCAGTACTTCTTTCCTGTGATCTTCAGCAAAGCTTCCGATTCCTTGCAGCTGGTCTTTGGCATCGAGCTGATGGAAGTGGACCCCATCGGCCACGTGTACATCTTTGCCACCTGCCTGGGCCTCTCCTACGATGGCCTGCTGGGTGACAATCAGATCATGCCCAAGACAGGCTTCCTGATAATCATCCTGGCCATAATCGCAAAAGAGGGCGACTGTGCCCCTGAGGAGAAAATCTGGGAGGAGCTGAGTGTGTTAGAGGTGTTTGAGGGGAGGGAAGACAGTATCTTCGGGGATCCCAAGAAGCTGCTCACCCAATATTTCGTGCAGGAAAACTACCTGGAGTACCGGCAGGTCCCCGGCAGTGATCCTGCATGCTATGAGTTCCTGTGGGGTCCAAGGGCCCTCATTGAAACCAGCTATGTGAAAGTCCTGCACCATATGGTAAAGATCAGTGGAGGACCTCGCATTTCCTACCCACTCCTGCATGAGTGGGCTTTGAGAGAGGGGGAAGAGTGA
ORF Protein Sequence MPLEQRSQHCKPEEGLEARGEALGLVGAQAPATEEQEAASSSSTLVEVTLGEVPAAESPDPPQSPQGASSLPTTMNYPLWSQSYEDSSNQEEEGPSTFPDLESEFQAALSRKVAKLVHFLLLKYRAREPVTKAEMLGSVVGNWQYFFPVIFSKASDSLQLVFGIELMEVDPIGHVYIFATCLGLSYDGLLGDNQIMPKTGFLIIILAIIAKEGDCAPEEKIWEELSVLEVFEGREDSIFGDPKKLLTQYFVQENYLEYRQVPGSDPACYEFLWGPRALIETSYVKVLHHMVKISGGPRISYPLLHEWALREGEE

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T57941-Ab Anti-MAGEA6 monoclonal antibody
    Target Antigen GM-Tg-g-T57941-Ag MAGEA6 protein
    ORF Viral Vector pGMLP004870 Human MAGEA6 Lentivirus plasmid
    ORF Viral Vector vGMLP004870 Human MAGEA6 Lentivirus particle


    Target information

    Target ID GM-T57941
    Target Name MAGEA6
    Gene ID 4105
    Gene Symbol and Synonyms CT1.6,MAGE-3b,MAGE3B,MAGE6,MAGEA6
    Uniprot Accession P43360
    Uniprot Entry Name MAGA6_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target, Immuno-oncology Target
    Disease Breast Cancer
    Gene Ensembl ENSG00000197172
    Target Classification Checkpoint-Immuno Oncology

    This gene is a member of the MAGEA gene family. The members of this family encode proteins with 50 to 80% sequence identity to each other. The promoters and first exons of the MAGEA genes show considerable variability, suggesting that the existence of this gene family enables the same function to be expressed under different transcriptional controls. The MAGEA genes are clustered at chromosomal location Xq28. They have been implicated in some hereditary disorders, such as dyskeratosis congenita. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.