Human GAS2/GAS-2 ORF/cDNA clone-Lentivirus plasmid (NM_177553)

Cat. No.: pGMLP004922
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human GAS2/GAS-2 Lentiviral expression plasmid for GAS2 lentivirus packaging, GAS2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to GAS2/GAS-2 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $535.5
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP004922
Gene Name GAS2
Accession Number NM_177553
Gene ID 2620
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 942 bp
Gene Alias GAS-2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTGCACTGCTCTGAGCCCAAAGGTACGCAGTGGACCTGGCCTCTCTGATATGCATCAGTATAGCCAATGGCTAGCCAGCAGACATGAAGCTAATTTGCTACCAATGAAAGAAGATCTGGCCTTGTGGTTAACCAATCTATTAGGGAAGGAGATTACAGCAGAAACTTTTATGGAGAAGTTGGACAATGGTGCCTTGCTCTGTCAACTTGCAGAAACTATGCAGGAGAAATTCAAGGAGAGCATGGATGCTAACAAGCCCACAAAGAATCTACCGTTGAAGAAGATCCCATGCAAAACCAGTGCACCCTCGGGCTCCTTTTTTGCCAGAGACAATACAGCAAATTTCTTATCCTGGTGCCGAGATTTAGGGGTGGATGAAACGTGTCTATTTGAATCGGAAGGTTTGGTCCTCCACAAGCAACCCAGAGAAGTGTGTCTCTGTCTGCTAGAGCTTGGCCGGATTGCAGCCAGGTATGGTGTGGAGCCTCCTGGTTTGATAAAGCTGGAAAAAGAGATTGAACAAGAAGAAACACTTTCTGCCCCTTCTCCTTCACCTTCTCCTTCATCAAAGTCTTCTGGAAAAAAGAGTACAGGAAACTTACTGGATGATGCAGTGAAACGAATTTCTGAAGATCCTCCTTGCAAATGCCCAAACAAGTTCTGTGTGGAGCGGCTCTCCCAAGGAAGATACCGAGTGGGAGAAAAGATCCTCTTCATTAGGATGCTGCACAACAAACATGTCATGGTCCGTGTGGGAGGAGGCTGGGAAACTTTTGCAGGGTATTTGTTGAAACACGACCCCTGCCGAATGCTGCAGATCTCCCGTGTGGATGGCAAAACATCCCCTATCCAAAGCAAATCTCCAACTCTAAAGGACATGAATCCAGATAACTACTTGGTGGTCTCTGCCAGTTATAAGGCTAAGAAGGAAATTAAGTGA
ORF Protein Sequence MCTALSPKVRSGPGLSDMHQYSQWLASRHEANLLPMKEDLALWLTNLLGKEITAETFMEKLDNGALLCQLAETMQEKFKESMDANKPTKNLPLKKIPCKTSAPSGSFFARDNTANFLSWCRDLGVDETCLFESEGLVLHKQPREVCLCLLELGRIAARYGVEPPGLIKLEKEIEQEETLSAPSPSPSPSSKSSGKKSTGNLLDDAVKRISEDPPCKCPNKFCVERLSQGRYRVGEKILFIRMLHNKHVMVRVGGGWETFAGYLLKHDPCRMLQISRVDGKTSPIQSKSPTLKDMNPDNYLVVSASYKAKKEIK

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP2521-Ab Anti-GAS2 monoclonal antibody
    Target Antigen GM-Tg-g-IP2521-Ag GAS2 protein
    ORF Viral Vector pGMLP004922 Human GAS2 Lentivirus plasmid
    ORF Viral Vector vGMLP004922 Human GAS2 Lentivirus particle


    Target information

    Target ID GM-IP2521
    Target Name GAS2
    Gene ID 2620, 14453, 700952, 499156, 101086419, 476889, 614840, 100057503
    Gene Symbol and Synonyms GAS-2,GAS2,RGD1563167
    Uniprot Accession O43903
    Uniprot Entry Name GAS2_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000148935
    Target Classification Not Available

    The protein encoded by this gene is a caspase-3 substrate that plays a role in regulating microfilament and cell shape changes during apoptosis. It can also modulate cell susceptibility to p53-dependent apoptosis by inhibiting calpain activity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2017]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.