Human EGFL8/C6orf8/ NG3 ORF/cDNA clone-Lentivirus plasmid (NM_030652)

Pre-made Human EGFL8/C6orf8/ NG3 Lentiviral expression plasmid for EGFL8 lentivirus packaging, EGFL8 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to EGFL8/C6orf8 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP004973 Human EGFL8 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP004973
Gene Name EGFL8
Accession Number NM_030652
Gene ID 80864
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 882 bp
Gene Alias C6orf8, NG3
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGGGTCCAGGGCTGAGCTGTGCACTCTCTTAGGCGGATTCTCCTTCCTCCTGCTACTGATACCAGGCGAGGGGGCCAAGGGTGGATCCCTCAGAGAGAGTCAGGGAGTCTGCTCCAAGCAGACACTGGTGGTCCCGCTCCACTACAACGAGTCCTACAGCCAACCAGTGTACAAGCCCTACCTGACCTTGTGCGCTGGGAGGCGCATCTGCAGCACTTACAGGACCATGTACCGCGTTATGTGGCGGGAGGTGAGGCGGGAGGTTCAGCAGACCCATGCAGTGTGCTGCCAGGGCTGGAAGAAGCGGCACCCGGGGGCGCTCACCTGTGAAGCCATCTGCGCCAAGCCTTGCCTGAACGGAGGCGTCTGCGTTAGGCCTGACCAGTGCGAGTGCGCCCCCGGCTGGGGAGGGAAGCACTGTCATGTGGACGTGGATGAATGTAGGACCAGCATCACCCTCTGCTCGCACCATTGTTTTAATACGGCAGGCAGCTTCACCTGCGGCTGCCCCCATGACCTAGTGCTAGGCGTGGACGGGCGCACCTGCATGGAGGGGTCCCCAGAGCCCCCAACCAGTGCCAGCATACTCAGCGTGGCCGTTCGGGAGGCGGAAAAAGATGAGCGCGCTCTGAAGCAGGAGATTCACGAGCTGCGAGGGCGCCTGGAGCGGCTGGAGCAGTGGGCCGGTCAGGCTGGGGCCTGGGTCAGAGCGGTGCTGCCCGTGCCGCCTGAAGAGCTGCAGCCAGAACAGGTGGCTGAGCTGTGGGGCCGGGGTGACCGGATCGAATCTCTCAGCGACCAGGTGCTGCTGCTGGAGGAGAGGCTAGGTGCCTGCTCCTGTGAGGACAACAGCCTGGGCCTCGGCGTCAATCATCGATAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0901-Ab Anti-EGFL8/ C6orf8/ NG3 functional antibody
    Target Antigen GM-Tg-g-SE0901-Ag EGFL8 protein
    Cytokine cks-Tg-g-GM-SE0901 EGF-like-domain, multiple 8 (EGFL8) protein & antibody
    ORF Viral Vector pGMLP004973 Human EGFL8 Lentivirus plasmid
    ORF Viral Vector vGMLP004973 Human EGFL8 Lentivirus particle


    Target information

    Target ID GM-SE0901
    Target Name EGFL8
    Gene ID 80864, 81701, 717145, 406166, 101095824, 481725, 782820
    Gene Symbol and Synonyms AGPAT1,C6orf8,EGFL8,NG3
    Uniprot Accession Q99944
    Uniprot Entry Name EGFL8_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Cytokine Target
    Disease Not Available
    Gene Ensembl ENSG00000241404
    Target Classification Not Available

    Predicted to enable signaling receptor binding activity. Predicted to be involved in anatomical structure development. Predicted to act upstream of or within in utero embryonic development. Predicted to be active in cell surface and extracellular region. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.