Human FGF3/HBGF-3/ INT2 ORF/cDNA clone-Lentivirus plasmid (NM_005247)

Pre-made Human FGF3/HBGF-3/ INT2 Lentiviral expression plasmid for FGF3 lentivirus packaging, FGF3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to FGF3/HBGF-3 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP004989 Human FGF3 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP004989
Gene Name FGF3
Accession Number NM_005247
Gene ID 2248
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 720 bp
Gene Alias HBGF-3, INT2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGGCCTAATCTGGCTGCTACTGCTCAGCCTGCTGGAGCCCGGCTGGCCCGCAGCGGGCCCTGGGGCGCGGTTGCGGCGCGATGCGGGCGGCCGTGGCGGCGTCTACGAGCACCTTGGCGGGGCGCCCCGGCGCCGCAAGCTCTACTGCGCCACGAAGTACCACCTCCAGCTGCACCCGAGCGGCCGCGTCAACGGCAGCCTGGAGAACAGCGCCTACAGTATTTTGGAGATAACGGCAGTGGAGGTGGGCATTGTGGCCATCAGGGGTCTCTTCTCCGGGCGGTACCTGGCCATGAACAAGAGGGGACGACTCTATGCTTCGGAGCACTACAGCGCCGAGTGCGAGTTTGTGGAGCGGATCCACGAGCTGGGCTATAATACGTATGCCTCCCGGCTGTACCGGACGGTGTCTAGTACGCCTGGGGCCCGCCGGCAGCCCAGCGCCGAGAGACTGTGGTACGTGTCTGTGAACGGCAAGGGCCGGCCCCGCAGGGGCTTCAAGACCCGCCGCACACAGAAGTCCTCCCTGTTCCTGCCCCGCGTGCTGGACCACAGGGACCACGAGATGGTGCGGCAGCTACAGAGTGGGCTGCCCAGACCCCCTGGTAAGGGGGTCCAGCCCCGACGGCGGCGGCAGAAGCAGAGCCCGGATAACCTGGAGCCCTCTCACGTTCAGGCTTCGAGACTGGGCTCCCAGCTGGAGGCCAGTGCGCACTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0921-Ab Anti-FGF3/ HBGF-3/ INT2 functional antibody
    Target Antigen GM-Tg-g-SE0921-Ag FGF3 protein
    Cytokine cks-Tg-g-GM-SE0921 fibroblast growth factor 3 (FGF3) protein & antibody
    ORF Viral Vector pGMLP004989 Human FGF3 Lentivirus plasmid
    ORF Viral Vector vGMLP004989 Human FGF3 Lentivirus particle


    Target information

    Target ID GM-SE0921
    Target Name FGF3
    Gene ID 2248, 14174, 708918, 170633, 111556666, 611707, 618481, 100146649
    Gene Symbol and Synonyms Fgf-3,FGF3,Fgf5c,HBGF-3,Int-2,Int-P,INT2
    Uniprot Accession P11487
    Uniprot Entry Name FGF3_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Cytokine Target
    Disease Cancer
    Gene Ensembl ENSG00000186895
    Target Classification Tumor-associated antigen (TAA)

    The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities and are involved in a variety of biological processes including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. This gene was identified by its similarity with mouse fgf3/int-2, a proto-oncogene activated in virally induced mammary tumors in the mouse. Frequent amplification of this gene has been found in human tumors, which may be important for neoplastic transformation and tumor progression. Studies of the similar genes in mouse and chicken suggested the role in inner ear formation. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.