Human MRM2/FJH1/ FTSJ2 ORF/cDNA clone-Lentivirus plasmid (NM_013393)

Pre-made Human MRM2/FJH1/ FTSJ2 Lentiviral expression plasmid for MRM2 lentivirus packaging, MRM2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to MRM2/FJH1 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP005009 Human MRM2 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP005009
Gene Name MRM2
Accession Number NM_013393
Gene ID 29960
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 741 bp
Gene Alias FJH1, FTSJ2, HEL97, RRMJ2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCGGGGTACTTGAAGCTGGTGTGTGTTTCCTTTCAGCGTCAAGGGTTCCACACTGTTGGGAGTCGCTGCAAGAATCGGACAGGCGCTGAGCACCTGTGGCTGACCCGACATCTCAGGGACCCATTTGTGAAGGCTGCGAAGGTGGAGAGTTACCGGTGTCGAAGCGCCTTCAAGCTCCTGGAGGTGAACGAGAGGCACCAGATTCTGCGGCCCGGCCTTCGGGTGTTAGACTGTGGGGCAGCTCCTGGGGCCTGGAGTCAGGTGGCGGTGCAGAAGGTCAACGCCGCAGGCACAGATCCCAGCTCTCCTGTTGGCTTCGTGCTTGGGGTAGATCTTCTTCACATATTCCCCCTGGAAGGAGCAACTTTTCTGTGCCCTGCTGACGTGACTGACCCGAGAACCTCACAGAGAATCCTCGAGGTGCTTCCTGGCAGGAGAGCAGATGTGATTCTGAGCGACATGGCGCCCAATGCCACAGGGTTCCGGGACCTCGATCATGACAGGCTCATCAGCCTGTGCCTGACCCTTCTCAGCGTGACCCCAGACATCCTGCAACCTGGGGGGACATTCCTTTGTAAAACCTGGGCTGGAAGTCAAAGCCGTCGGTTACAGAGGAGACTGACAGAGGAATTCCAGAATGTAAGGATCATCAAACCTGAAGCCAGCAGGAAAGAGTCATCAGAAGTGTACTTCTTGGCCACACAGTACCACGGAAGGAAGGGCACTGTGAAGCAGTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T98917-Ab Anti-MRM2 monoclonal antibody
    Target Antigen GM-Tg-g-T98917-Ag MRM2 protein
    ORF Viral Vector pGMLP005009 Human MRM2 Lentivirus plasmid
    ORF Viral Vector vGMLP005009 Human MRM2 Lentivirus particle


    Target information

    Target ID GM-T98917
    Target Name MRM2
    Gene ID 29960, 68017, 698100, 304323, 101090822, 100684914, 790010, 100059590
    Gene Symbol and Synonyms 2310037B18Rik,FJH1,FTSJ2,HEL97,MRM2,MTDPS17,RRMJ2
    Uniprot Accession Q9UI43
    Uniprot Entry Name MRM2_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000122687
    Target Classification Not Available

    The protein encoded by this gene is a member of the S-adenosylmethionine-binding protein family. It is a nucleolar protein and it may be involved in the processing and modification of rRNA. This gene has been suggested to be involved in cell cycle control and DNA repair. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.