Human HAVCR2/CD366/ HAVcr-2 ORF/cDNA clone-Lentivirus plasmid (NM_032782)
Pre-made Human HAVCR2/CD366/ HAVcr-2 Lentiviral expression plasmid for HAVCR2 lentivirus packaging, HAVCR2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to CD366/HAVCR2 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP005033 | Human HAVCR2 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP005033 |
Gene Name | HAVCR2 |
Accession Number | NM_032782 |
Gene ID | 84868 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 906 bp |
Gene Alias | CD366, HAVcr-2, KIM-3, Tim-3, TIM3, TIMD-3, TIMD3 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGTTTTCACATCTTCCCTTTGACTGTGTCCTGCTGCTGCTGCTGCTACTACTTACAAGGTCCTCAGAAGTGGAATACAGAGCGGAGGTCGGTCAGAATGCCTATCTGCCCTGCTTCTACACCCCAGCCGCCCCAGGGAACCTCGTGCCCGTCTGCTGGGGCAAAGGAGCCTGTCCTGTGTTTGAATGTGGCAACGTGGTGCTCAGGACTGATGAAAGGGATGTGAATTATTGGACATCCAGATACTGGCTAAATGGGGATTTCCGCAAAGGAGATGTGTCCCTGACCATAGAGAATGTGACTCTAGCAGACAGTGGGATCTACTGCTGCCGGATCCAAATCCCAGGCATAATGAATGATGAAAAATTTAACCTGAAGTTGGTCATCAAACCAGCCAAGGTCACCCCTGCACCGACTCGGCAGAGAGACTTCACTGCAGCCTTTCCAAGGATGCTTACCACCAGGGGACATGGCCCAGCAGAGACACAGACACTGGGGAGCCTCCCTGATATAAATCTAACACAAATATCCACATTGGCCAATGAGTTACGGGACTCTAGATTGGCCAATGACTTACGGGACTCTGGAGCAACCATCAGAATAGGCATCTACATCGGAGCAGGGATCTGTGCTGGGCTGGCTCTGGCTCTTATCTTCGGCGCTTTAATTTTCAAATGGTATTCTCATAGCAAAGAGAAGATACAGAATTTAAGCCTCATCTCTTTGGCCAACCTCCCTCCCTCAGGATTGGCAAATGCAGTAGCAGAGGGAATTCGCTCAGAAGAAAACATCTATACCATTGAAGAGAACGTATATGAAGTGGAGGAGCCCAATGAGTATTATTGCTATGTCAGCAGCAGGCAGCAACCCTCACAACCTTTGGGTTGTCGCTTTGCAATGCCATAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Biosimilar | GMP-Bios-ab-502 | Pre-Made Sabatolimab biosimilar, Whole mAb, Anti-HAVCR2/TIM3 Antibody: Anti-CD366/KIM-3/SPTCL/TIMD3/Tim-3/TIMD-3/HAVcr-2 therapeutic antibody |
Biosimilar | GMP-Bios-ab-536 | Pre-Made Surzebiclimab biosimilar, Whole mAb, Anti-HAVCR2/TIM3 Antibody: Anti-CD366/KIM-3/SPTCL/TIMD3/Tim-3/TIMD-3/HAVcr-2 therapeutic antibody |
Biosimilar | GMP-Bios-ab-113 | Pre-Made Cobolimab biosimilar, Whole mAb, Anti-HAVCR2/TIM3 Antibody: Anti-CD366/KIM-3/SPTCL/TIMD3/Tim-3/TIMD-3/HAVcr-2 therapeutic antibody |
Target Antibody | GM-Tg-g-IP0004-Ab | Anti-CD366 monoclonal antibody |
Target Antigen | GM-Tg-g-IP0004-Ag | CD366/HAVCR2 protein |
ORF Viral Vector | pGMLP005033 | Human HAVCR2 Lentivirus plasmid |
ORF Viral Vector | vGMLP005033 | Human HAVCR2 Lentivirus particle |
Target information
Target ID | GM-IP0004 |
Target Name | CD366 |
Gene ID | 84868, 171285, 714891, 363578, 101089981, 479318, 768047, 100071246 |
Gene Symbol and Synonyms | CD366,HAVcr-2,HAVCR2,KIM-3,SPTCL,Tim-3,TIM3,TIMD-3,TIMD3 |
Uniprot Accession | Q8TDQ0 |
Uniprot Entry Name | HAVR2_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target, Immuno-oncology Target, INN Index |
Disease | Not Available |
Gene Ensembl | ENSG00000135077 |
Target Classification | Checkpoint-Immuno Oncology |
The protein encoded by this gene belongs to the immunoglobulin superfamily, and TIM family of proteins. CD4-positive T helper lymphocytes can be divided into types 1 (Th1) and 2 (Th2) on the basis of their cytokine secretion patterns. Th1 cells are involved in cell-mediated immunity to intracellular pathogens and delayed-type hypersensitivity reactions, whereas, Th2 cells are involved in the control of extracellular helminthic infections and the promotion of atopic and allergic diseases. This protein is a Th1-specific cell surface protein that regulates macrophage activation, and inhibits Th1-mediated auto- and alloimmune responses, and promotes immunological tolerance. [provided by RefSeq, Sep 2011]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.