Human HAVCR2/CD366/ HAVcr-2 ORF/cDNA clone-Lentivirus plasmid (NM_032782)

Pre-made Human HAVCR2/CD366/ HAVcr-2 Lentiviral expression plasmid for HAVCR2 lentivirus packaging, HAVCR2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to CD366/HAVCR2 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP005033 Human HAVCR2 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP005033
Gene Name HAVCR2
Accession Number NM_032782
Gene ID 84868
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 906 bp
Gene Alias CD366, HAVcr-2, KIM-3, Tim-3, TIM3, TIMD-3, TIMD3
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGTTTTCACATCTTCCCTTTGACTGTGTCCTGCTGCTGCTGCTGCTACTACTTACAAGGTCCTCAGAAGTGGAATACAGAGCGGAGGTCGGTCAGAATGCCTATCTGCCCTGCTTCTACACCCCAGCCGCCCCAGGGAACCTCGTGCCCGTCTGCTGGGGCAAAGGAGCCTGTCCTGTGTTTGAATGTGGCAACGTGGTGCTCAGGACTGATGAAAGGGATGTGAATTATTGGACATCCAGATACTGGCTAAATGGGGATTTCCGCAAAGGAGATGTGTCCCTGACCATAGAGAATGTGACTCTAGCAGACAGTGGGATCTACTGCTGCCGGATCCAAATCCCAGGCATAATGAATGATGAAAAATTTAACCTGAAGTTGGTCATCAAACCAGCCAAGGTCACCCCTGCACCGACTCGGCAGAGAGACTTCACTGCAGCCTTTCCAAGGATGCTTACCACCAGGGGACATGGCCCAGCAGAGACACAGACACTGGGGAGCCTCCCTGATATAAATCTAACACAAATATCCACATTGGCCAATGAGTTACGGGACTCTAGATTGGCCAATGACTTACGGGACTCTGGAGCAACCATCAGAATAGGCATCTACATCGGAGCAGGGATCTGTGCTGGGCTGGCTCTGGCTCTTATCTTCGGCGCTTTAATTTTCAAATGGTATTCTCATAGCAAAGAGAAGATACAGAATTTAAGCCTCATCTCTTTGGCCAACCTCCCTCCCTCAGGATTGGCAAATGCAGTAGCAGAGGGAATTCGCTCAGAAGAAAACATCTATACCATTGAAGAGAACGTATATGAAGTGGAGGAGCCCAATGAGTATTATTGCTATGTCAGCAGCAGGCAGCAACCCTCACAACCTTTGGGTTGTCGCTTTGCAATGCCATAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-502 Pre-Made Sabatolimab biosimilar, Whole mAb, Anti-HAVCR2/TIM3 Antibody: Anti-CD366/KIM-3/SPTCL/TIMD3/Tim-3/TIMD-3/HAVcr-2 therapeutic antibody
    Biosimilar GMP-Bios-ab-536 Pre-Made Surzebiclimab biosimilar, Whole mAb, Anti-HAVCR2/TIM3 Antibody: Anti-CD366/KIM-3/SPTCL/TIMD3/Tim-3/TIMD-3/HAVcr-2 therapeutic antibody
    Biosimilar GMP-Bios-ab-113 Pre-Made Cobolimab biosimilar, Whole mAb, Anti-HAVCR2/TIM3 Antibody: Anti-CD366/KIM-3/SPTCL/TIMD3/Tim-3/TIMD-3/HAVcr-2 therapeutic antibody
    Target Antibody GM-Tg-g-IP0004-Ab Anti-CD366 monoclonal antibody
    Target Antigen GM-Tg-g-IP0004-Ag CD366/HAVCR2 protein
    ORF Viral Vector pGMLP005033 Human HAVCR2 Lentivirus plasmid
    ORF Viral Vector vGMLP005033 Human HAVCR2 Lentivirus particle


    Target information

    Target ID GM-IP0004
    Target Name CD366
    Gene ID 84868, 171285, 714891, 363578, 101089981, 479318, 768047, 100071246
    Gene Symbol and Synonyms CD366,HAVcr-2,HAVCR2,KIM-3,SPTCL,Tim-3,TIM3,TIMD-3,TIMD3
    Uniprot Accession Q8TDQ0
    Uniprot Entry Name HAVR2_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target, Immuno-oncology Target, INN Index
    Disease Not Available
    Gene Ensembl ENSG00000135077
    Target Classification Checkpoint-Immuno Oncology

    The protein encoded by this gene belongs to the immunoglobulin superfamily, and TIM family of proteins. CD4-positive T helper lymphocytes can be divided into types 1 (Th1) and 2 (Th2) on the basis of their cytokine secretion patterns. Th1 cells are involved in cell-mediated immunity to intracellular pathogens and delayed-type hypersensitivity reactions, whereas, Th2 cells are involved in the control of extracellular helminthic infections and the promotion of atopic and allergic diseases. This protein is a Th1-specific cell surface protein that regulates macrophage activation, and inhibits Th1-mediated auto- and alloimmune responses, and promotes immunological tolerance. [provided by RefSeq, Sep 2011]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.