Human GPHB5/B5/GPB5 ORF/cDNA clone-Lentivirus plasmid (NM_145171)

Cat. No.: pGMLP005063
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human GPHB5/B5/GPB5 Lentiviral expression plasmid for GPHB5 lentivirus packaging, GPHB5 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to GPHB5/B5 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $450
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP005063
Gene Name GPHB5
Accession Number NM_145171
Gene ID 122876
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 393 bp
Gene Alias B5,GPB5,ZLUT1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAAGCTGGCATTCCTCTTCCTTGGCCCCATGGCCCTCCTCCTTCTGGCTGGCTATGGCTGTGTCCTCGGTGCCTCCAGTGGGAACCTGCGCACCTTTGTGGGCTGTGCCGTGAGGGAGTTTACTTTCCTGGCCAAGAAGCCAGGCTGCAGGGGCCTTCGGATCACCACGGATGCCTGCTGGGGTCGCTGTGAGACCTGGGAGAAACCCATTCTGGAACCCCCCTATATTGAAGCCCATCATCGAGTCTGTACCTACAACGAGACCAAACAGGTGACTGTCAAGCTGCCCAACTGTGCCCCGGGAGTCGACCCCTTCTACACCTATCCCGTGGCCATCCGCTGTGACTGCGGAGCCTGCTCCACTGCCACCACGGAGTGTGAGACCATCTGA
ORF Protein Sequence MKLAFLFLGPMALLLLAGYGCVLGASSGNLRTFVGCAVREFTFLAKKPGCRGLRITTDACWGRCETWEKPILEPPYIEAHHRVCTYNETKQVTVKLPNCAPGVDPFYTYPVAIRCDCGACSTATTECETI

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0953-Ab Anti-GPHB5/ B5/ GPB5 functional antibody
    Target Antigen GM-Tg-g-SE0953-Ag GPHB5 protein
    ORF Viral Vector pGMLP005063 Human GPHB5 Lentivirus plasmid
    ORF Viral Vector vGMLP005063 Human GPHB5 Lentivirus particle


    Target information

    Target ID GM-SE0953
    Target Name GPHB5
    Gene ID 122876, 217674, 705722, 366668, 101085046, 490726, 539408, 100051886
    Gene Symbol and Synonyms B5,GPB5,GPHB5,OGH,ZLUT1
    Uniprot Accession Q86YW7
    Uniprot Entry Name GPHB5_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000179600
    Target Classification Not Available

    GPHB5 is a cystine knot-forming polypeptide and a subunit of the dimeric glycoprotein hormone family (Hsu et al., 2002 [PubMed 12089349]).[supplied by OMIM, Mar 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.