Human FMR1NB/CT37/NY-SAR-35 ORF/cDNA clone-Lentivirus plasmid (NM_152578)

Cat. No.: pGMLP005082
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human FMR1NB/CT37/NY-SAR-35 Lentiviral expression plasmid for FMR1NB lentivirus packaging, FMR1NB lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to FMR1NB/CT37 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $492
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP005082
Gene Name FMR1NB
Accession Number NM_152578
Gene ID 158521
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 768 bp
Gene Alias CT37,NY-SAR-35,NYSAR35
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTCTTCACATAGGAGGAAAGCGAAGGGGAGGAATAGGAGAAGTCACCGTGCCATGCGTGTGGCTCACTTAGAGCTGGCAACTTATGAGTTGGCGGCAACTGAGTCGAATCCCGAGAGCAGCCATCCTGGATACGAGGCCGCCATGGCTGACAGGCCTCAGCCAGGATGGCGGGAATCTCTAAAGATGCGGGTCAGCAAACCCTTTGGGATGCTCATGCTCTCCATTTGGATCCTGCTGTTCGTGTGCTACTACCTGTCCTACTACCTGTGCTCCGGGTCCTCATATTTTGTGCTTGCAAATGGACATATCCTGCCCAACAGTGAAAATGCTCATGGCCAATCTCTGGAAGAAGATTCCGCATTGGAAGCTTTGCTGAATTTTTTCTTTCCAACAACTTGCAATCTGAGGGAAAATCAGGTGGCAAAGCCTTGTAATGAGCTGCAAGATCTTAGTGAGAGTGAATGTTTGAGACACAAATGCTGTTTTTCATCATCGGGGACCACGAGCTTCAAATGTTTTGCTCCATTTAGAGATGTGCCTAAACAGATGATGCAAATGTTTGGGCTTGGTGCGATCAGCCTTATCCTGGTATGTCTGCCCATTTATTGCCGCTCTCTTTTCTGGAGGAGCGAACCGGCCGATGATTTACAAAGGCAGGACAACAGAGTTGTAACGGGTTTGAAGAAACAAAGAAGGAAGCGAAAGAGGAAGTCTGAAATGTTACAGAAAGCAGCAAGAGGACGTGAGGAACATGGTGACGAGTAG
ORF Protein Sequence MSSHRRKAKGRNRRSHRAMRVAHLELATYELAATESNPESSHPGYEAAMADRPQPGWRESLKMRVSKPFGMLMLSIWILLFVCYYLSYYLCSGSSYFVLANGHILPNSENAHGQSLEEDSALEALLNFFFPTTCNLRENQVAKPCNELQDLSESECLRHKCCFSSSGTTSFKCFAPFRDVPKQMMQMFGLGAISLILVCLPIYCRSLFWRSEPADDLQRQDNRVVTGLKKQRRKRKRKSEMLQKAARGREEHGDE

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0857-Ab Anti-FMR1NB monoclonal antibody
    Target Antigen GM-Tg-g-IP0857-Ag FMR1NB protein
    ORF Viral Vector pGMLP005082 Human FMR1NB Lentivirus plasmid
    ORF Viral Vector vGMLP005082 Human FMR1NB Lentivirus particle


    Target information

    Target ID GM-IP0857
    Target Name FMR1NB
    Gene ID 158521, 207854, 704191, 293918, 102899812, 481071, 613334, 102148699
    Gene Symbol and Synonyms 3830422N12Rik,CT37,FMR1NB,NY-SAR-35,NYSAR35,RGD1564059
    Uniprot Accession Q8N0W7
    Uniprot Entry Name FMR1N_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000176988
    Target Classification Not Available

    Predicted to be integral component of membrane. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.