Human HSD17B12/KAR/SDR12C1 ORF/cDNA clone-Lentivirus plasmid (NM_016142)

Cat. No.: pGMLP005141
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human HSD17B12/KAR/SDR12C1 Lentiviral expression plasmid for HSD17B12 lentivirus packaging, HSD17B12 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to HSD17B12/KAR products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $534.75
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP005141
Gene Name HSD17B12
Accession Number NM_016142
Gene ID 51144
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 939 bp
Gene Alias KAR,SDR12C1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGAGAGCGCTCTCCCCGCCGCCGGCTTCCTGTACTGGGTCGGCGCGGGCACCGTGGCCTACCTAGCCCTGCGTATTTCGTACTCGCTCTTCACGGCCCTCCGGGTCTGGGGAGTGGGGAATGAGGCGGGGGTCGGCCCGGGGCTCGGAGAATGGGCAGTTGTCACAGGTAGTACTGATGGAATTGGAAAATCATATGCAGAAGAGTTAGCAAAGCATGGAATGAAGGTTGTCCTTATCAGCAGATCAAAGGATAAACTTGACCAGGTTTCCAGTGAAATAAAAGAAAAATTCAAAGTGGAGACAAGAACCATTGCTGTTGACTTTGCATCAGAAGATATTTATGATAAAATTAAAACAGGCTTGGCTGGTCTTGAAATCGGCATCTTAGTGAACAACGTGGGAATGTCGTATGAGTATCCTGAATACTTTTTGGATGTTCCTGACTTGGACAATGTGATCAAGAAAATGATAAATATTAATATTCTTTCTGTTTGTAAGATGACACAATTGGTACTGCCTGGCATGGTGGAAAGATCCAAAGGGGCTATTCTGAACATTTCATCTGGCAGTGGCATGCTCCCTGTCCCACTCTTGACCATCTATTCTGCAACCAAGACTTTTGTAGATTTCTTCTCTCAGTGCCTCCATGAGGAGTATAGGAGCAAGGGCGTCTTTGTGCAGAGTGTCCTGCCATACTTCGTAGCTACAAAACTGGCTAAAATCCGGAAGCCAACTTTGGATAAGCCCTCTCCGGAGACGTTTGTGAAGTCTGCAATTAAAACAGTCGGCCTGCAATCCCGAACCAATGGATACCTGATCCATGCTCTTATGGGCTCGATAATCTCAAACCTGCCTTCTTGGATTTATTTGAAAATAGTCATGAATATGAACAAGTCTACACGGGCTCACTATCTGAAGAAAACCAAGAAGAACTAA
ORF Protein Sequence MESALPAAGFLYWVGAGTVAYLALRISYSLFTALRVWGVGNEAGVGPGLGEWAVVTGSTDGIGKSYAEELAKHGMKVVLISRSKDKLDQVSSEIKEKFKVETRTIAVDFASEDIYDKIKTGLAGLEIGILVNNVGMSYEYPEYFLDVPDLDNVIKKMININILSVCKMTQLVLPGMVERSKGAILNISSGSGMLPVPLLTIYSATKTFVDFFSQCLHEEYRSKGVFVQSVLPYFVATKLAKIRKPTLDKPSPETFVKSAIKTVGLQSRTNGYLIHALMGSIISNLPSWIYLKIVMNMNKSTRAHYLKKTKKN

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0270-Ab Anti-DHB12/ HSD17B12/ KAR functional antibody
    Target Antigen GM-Tg-g-SE0270-Ag HSD17B12 protein
    ORF Viral Vector pGMLP005141 Human HSD17B12 Lentivirus plasmid
    ORF Viral Vector vGMLP005141 Human HSD17B12 Lentivirus particle


    Target information

    Target ID GM-SE0270
    Target Name HSD17B12
    Gene ID 51144, 56348, 106993263, 84013, 101082595, 475939, 789567, 100050075
    Gene Symbol and Synonyms 2610510O05Rik,HSD17B12,KAR,KIK-I,Kik1,SDR12C1
    Uniprot Accession Q53GQ0
    Uniprot Entry Name DHB12_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000149084
    Target Classification Not Available

    This gene encodes a very important 17beta-hydroxysteroid dehydrogenase (17beta-HSD) that converts estrone into estradiol in ovarian tissue. This enzyme is also involved in fatty acid elongation. [provided by RefSeq, Oct 2011]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.