Human PDXP/CIN/dJ37E16.5 ORF/cDNA clone-Lentivirus plasmid (NM_020315)

Cat. No.: pGMLP005145
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human PDXP/CIN/dJ37E16.5 Lentiviral expression plasmid for PDXP lentivirus packaging, PDXP lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to PDXP/CIN products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $522.75
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP005145
Gene Name PDXP
Accession Number NM_020315
Gene ID 57026
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 891 bp
Gene Alias CIN,dJ37E16.5,PLP
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCGCGCTGCGAGAGGCTGCGCGGAGCGGCCCTGCGCGACGTGCTGGGCCGGGCGCAGGGGGTCCTGTTCGACTGTGACGGGGTGCTGTGGAACGGCGAGCGCGCCGTGCCGGGCGCCCCGGAGCTGCTGGAGCGGCTGGCGCGGGCCGGCAAGGCGGCTCTGTTTGTGAGCAACAACAGCCGGCGCGCGCGGCCCGAGCTGGCCCTGCGCTTCGCGCGCCTCGGCTTCGGGGGGCTGCGCGCCGAGCAGCTCTTCAGCTCCGCGCTGTGCGCCGCGCGCCTGCTGCGCCAGCGCCTGCCCGGGCCTCCGGACGCGCCGGGCGCCGTGTTCGTGCTGGGCGGCGAGGGGCTGCGCGCCGAGCTGCGCGCCGCGGGGCTGCGCCTGGCCGGGGACCCGAGCGCGGGGGACGGCGCGGCCCCGCGCGTGCGCGCCGTGCTTGTGGGCTACGACGAGCACTTCTCCTTCGCCAAGCTGAGGGAGGCGTGCGCGCACCTGCGCGACCCCGAGTGCCTACTCGTGGCCACCGACCGTGACCCATGGCACCCGCTGAGCGACGGCAGCCGGACCCCTGGCACCGGGAGCCTGGCCGCTGCAGTGGAGACAGCCTCGGGACGCCAGGCCCTGGTGGTGGGCAAGCCCAGCCCCTACATGTTCGAGTGCATCACGGAGAACTTCAGCATCGACCCCGCACGCACGCTTATGGTGGGTGACCGCCTGGAGACCGACATCCTCTTTGGCCACCGCTGCGGCATGACCACTGTGCTCACGCTCACAGGAGTCTCCCGCCTAGAAGAGGCCCAGGCCTACCTAGCGGCCGGCCAGCACGACCTCGTGCCCCATTACTATGTGGAGAGCATCGCAGACTTGACAGAGGGGTTGGAGGACTGA
ORF Protein Sequence MARCERLRGAALRDVLGRAQGVLFDCDGVLWNGERAVPGAPELLERLARAGKAALFVSNNSRRARPELALRFARLGFGGLRAEQLFSSALCAARLLRQRLPGPPDAPGAVFVLGGEGLRAELRAAGLRLAGDPSAGDGAAPRVRAVLVGYDEHFSFAKLREACAHLRDPECLLVATDRDPWHPLSDGSRTPGTGSLAAAVETASGRQALVVGKPSPYMFECITENFSIDPARTLMVGDRLETDILFGHRCGMTTVLTLTGVSRLEEAQAYLAAGQHDLVPHYYVESIADLTEGLED

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T02587-Ab Anti-PDXP monoclonal antibody
    Target Antigen GM-Tg-g-T02587-Ag PDXP protein
    ORF Viral Vector pGMLP005145 Human PDXP Lentivirus plasmid
    ORF Viral Vector vGMLP005145 Human PDXP Lentivirus particle


    Target information

    Target ID GM-T02587
    Target Name PDXP
    Gene ID 57026, 57028, 727679, 101093872, 100688635, 506308, 100630816
    Gene Symbol and Synonyms 1600027H05Rik,CIN,dJ37E16.5,PDXP,PLP,PLPP,Rbp1
    Uniprot Accession Q96GD0
    Uniprot Entry Name PLPP_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000241360
    Target Classification Not Available

    Pyridoxal 5-prime-phosphate (PLP) is the active form of vitamin B6 that acts as a coenzyme in maintaining biochemical homeostasis. The preferred degradation route from PLP to 4-pyridoxic acid involves the dephosphorylation of PLP by PDXP (Jang et al., 2003 [PubMed 14522954]).[supplied by OMIM, Mar 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.