Human SPP2/SPP-24/ SPP24 ORF/cDNA clone-Lentivirus plasmid (NM_006944)

Pre-made Human SPP2/SPP-24/ SPP24 Lentiviral expression plasmid for SPP2 lentivirus packaging, SPP2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to SPP2/SPP-24 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP005151 Human SPP2 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP005151
Gene Name SPP2
Accession Number NM_006944
Gene ID 6694
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 636 bp
Gene Alias SPP-24, SPP24
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGATTTCCAGAATGGAGAAGATGACGATGATGATGAAGATATTGATTATGTTTGCTCTTGGAATGAACTACTGGTCTTGCTCAGGTTTCCCAGTGTACGACTACGATCCATCCTCCTTAAGGGATGCCCTCAGTGCCTCTGTGGTAAAAGTGAATTCCCAGTCACTGAGTCCGTATCTGTTTCGGGCATTCAGAAGCTCATTAAAAAGAGTTGAGGTCCTAGATGAGAACAACTTGGTCATGAATTTAGAGTTCAGCATCCGGGAGACTACATGCAGGAAGGATTCTGGAGAAGATCCCGCTACATGTGCCTTCCAGAGGGACTACTATGTGTCCACAGCTGTTTGCAGAAGCACCGTGAAGGTATCTGCCCAGCAGGTGCAGGGCGTGCATGCTCGCTGCAGCTGGTCCTCCTCCACGTCTGAGTCTTACAGCAGCGAAGAGATGATTTTTGGGGACATGTTGGGATCTCATAAATGGAGAAACAATTATCTATTTGGTCTCATTTCAGACGAGTCCATAAGTGAACAATTTTATGATCGGTCACTTGGGATCATGAGAAGGGTATTGCCTCCTGGAAACAGAAGGTACCCAAACCACCGGCACAGAGCAAGAATAAATACTGACTTTGAGTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1319-Ab Anti-SPP24/ SPP2/ SPP-244 functional antibody
    Target Antigen GM-Tg-g-SE1319-Ag SPP2 protein
    ORF Viral Vector pGMLP005151 Human SPP2 Lentivirus plasmid
    ORF Viral Vector vGMLP005151 Human SPP2 Lentivirus particle


    Target information

    Target ID GM-SE1319
    Target Name SPP2
    Gene ID 6694, 75396, 718239, 94168, 101101496, 610394, 281500, 100065471
    Gene Symbol and Synonyms 0610038O04Rik,pp-24,SPP-24,SPP2,SPP24
    Uniprot Accession Q13103
    Uniprot Entry Name SPP24_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Ovary Cancer
    Gene Ensembl ENSG00000072080
    Target Classification Not Available

    This gene encodes a secreted phosphoprotein that is a member of the cystatin superfamily. [provided by RefSeq, Oct 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.