Human DCAKD ORF/cDNA clone-Lentivirus plasmid (NM_024819.6)

Cat. No.: pGMLP005247
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human DCAKD/ Lentiviral expression plasmid for DCAKD lentivirus packaging, DCAKD lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to DCAKD/ products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $474
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP005247
Gene Name DCAKD
Accession Number NM_024819.6
Gene ID 79877
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 696 bp
Gene Alias
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTTTCTGGTGGGCCTGACAGGGGGCATTGCCTCAGGCAAGAGCTCAGTGATCCAGGTGTTCCAGCAGCTGGGCTGTGCGGTGATTGACGTGGACGTGATGGCCCGGCACGTCGTGCAGCCAGGATACCCTGCCCACCGGCGCATCGTAGAGGTCTTCGGCACTGAGGTCTTGCTGGAGAACGGCGACATAAATCGCAAGGTCCTGGGGGACCTGATCTTTAACCAGCCTGACCGGCGGCAGCTGCTCAACGCCATCACCCACCCCGAGATTCGCAAGGAGATGATGAAGGAGACGTTCAAGTACTTCCTCCGGGGATACCGCTACGTGATTCTGGATATCCCCCTGCTGTTTGAGACCAAGAAGTTGCTCAAGTACATGAAGCACACCGTGGTAGTATACTGCGACCGGGACACACAGCTGGCACGGCTGATGCGGCGGAACAGCCTGAACCGCAAGGACGCAGAGGCCCGCATCAATGCCCAGCTGCCCCTGACAGACAAGGCCCGCATGGCCCGCCATGTCCTAGACAACTCGGGCGAGTGGAGTGTCACCAAACGCCAGGTCATCCTCTTGCACACTGAGCTGGAGCGCTCCCTGGAGTACCTGCCGCTGAGGTTTGGGGTCCTCACAGGGCTCGCTGCCATTGCCAGCCTCCTCTACCTGCTCACCCACTACCTTCTGCCTTACGCCTAG
ORF Protein Sequence MFLVGLTGGIASGKSSVIQVFQQLGCAVIDVDVMARHVVQPGYPAHRRIVEVFGTEVLLENGDINRKVLGDLIFNQPDRRQLLNAITHPEIRKEMMKETFKYFLRGYRYVILDIPLLFETKKLLKYMKHTVVVYCDRDTQLARLMRRNSLNRKDAEARINAQLPLTDKARMARHVLDNSGEWSVTKRQVILLHTELERSLEYLPLRFGVLTGLAAIASLLYLLTHYLLPYA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0668-Ab Anti-DCAKD monoclonal antibody
    Target Antigen GM-Tg-g-IP0668-Ag DCAKD protein
    ORF Viral Vector pGMLP005247 Human DCAKD Lentivirus plasmid
    ORF Viral Vector vGMLP005247 Human DCAKD Lentivirus particle


    Target information

    Target ID GM-IP0668
    Target Name DCAKD
    Gene ID 79877, 68087, 715841, 360639, 101082449, 490930, 508778, 100064169
    Gene Symbol and Synonyms 3010024O21Rik,6720485C15Rik,DCAKD
    Uniprot Accession Q8WVC6
    Uniprot Entry Name DCAKD_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000172992
    Target Classification Not Available

    Predicted to enable dephospho-CoA kinase activity. Predicted to be involved in coenzyme A biosynthetic process. Located in membrane. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.