Human FN3K ORF/cDNA clone-Lentivirus plasmid (NM_022158.3)

Cat. No.: pGMLP005269
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human FN3K/ Lentiviral expression plasmid for FN3K lentivirus packaging, FN3K lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to FN3K/ products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $532.5
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP005269
Gene Name FN3K
Accession Number NM_022158.3
Gene ID 64122
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 930 bp
Gene Alias
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGAGCAGCTGCTGCGCGCCGAGCTGCGCACCGCGACCCTGCGGGCCTTCGGCGGCCCCGGCGCCGGCTGCATCAGCGAGGGCCGAGCCTACGACACGGACGCAGGCCCAGTGTTCGTCAAAGTCAACCGCAGGACGCAGGCCCGGCAGATGTTTGAGGGGGAGGTGGCCAGCCTGGAGGCCCTCCGGAGCACGGGCCTGGTGCGGGTGCCGAGGCCCATGAAGGTCATCGACCTGCCGGGAGGTGGGGCCGCCTTTGTGATGGAGCATTTGAAGATGAAGAGCTTGAGCAGTCAAGCATCAAAACTTGGAGAGCAGATGGCAGATTTGCATCTTTACAACCAGAAGCTCAGGGAGAAGTTGAAGGAGGAGGAGAACACAGTGGGCCGAAGAGGTGAGGGTGCTGAGCCTCAGTATGTGGACAAGTTCGGCTTCCACACGGTGACGTGCTGCGGCTTCATCCCGCAGGTGAATGAGTGGCAGGATGACTGGCCGACCTTTTTCGCCCGGCACCGGCTCCAGGCGCAGCTGGACCTCATTGAGAAGGACTATGCTGACCGAGAGGCACGAGAACTCTGGTCCCGGCTACAGGTGAAGATCCCGGATCTGTTTTGTGGCCTAGAGATTGTCCCCGCGTTGCTCCACGGGGATCTCTGGTCGGGAAACGTGGCTGAGGACGACGTGGGGCCCATTATTTACGACCCGGCTTCCTTCTATGGCCATTCCGAGTTTGAACTGGCAATCGCCTTGATGTTTGGGGGGTTCCCCAGATCCTTCTTCACCGCCTACCACCGGAAGATCCCCAAGGCTCCGGGCTTCGACCAGCGGCTGCTGCTCTACCAGCTGTTTAACTACCTGAACCACTGGAACCACTTCGGGCGGGAGTACAGGAGCCCTTCCTTGGGCACCATGCGAAGGCTGCTCAAGTAG
ORF Protein Sequence MEQLLRAELRTATLRAFGGPGAGCISEGRAYDTDAGPVFVKVNRRTQARQMFEGEVASLEALRSTGLVRVPRPMKVIDLPGGGAAFVMEHLKMKSLSSQASKLGEQMADLHLYNQKLREKLKEEENTVGRRGEGAEPQYVDKFGFHTVTCCGFIPQVNEWQDDWPTFFARHRLQAQLDLIEKDYADREARELWSRLQVKIPDLFCGLEIVPALLHGDLWSGNVAEDDVGPIIYDPASFYGHSEFELAIALMFGGFPRSFFTAYHRKIPKAPGFDQRLLLYQLFNYLNHWNHFGREYRSPSLGTMRRLLK

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T92296-Ab Anti-FN3K monoclonal antibody
    Target Antigen GM-Tg-g-T92296-Ag FN3K protein
    ORF Viral Vector pGMLP005269 Human FN3K Lentivirus plasmid
    ORF Viral Vector vGMLP005269 Human FN3K Lentivirus particle


    Target information

    Target ID GM-T92296
    Target Name FN3K
    Gene ID 64122, 63828, 106994166, 498034, 101093222, 608337, 539709, 100056532
    Gene Symbol and Synonyms 2310074G21Rik,FN3K,Fnsk
    Uniprot Accession Q9H479
    Uniprot Entry Name FN3K_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000167363
    Target Classification Not Available

    A high concentration of glucose can result in non-enzymatic oxidation of proteins by reaction of glucose and lysine residues (glycation). Proteins modified in this way, fructosamines, are less active or functional. This gene encodes an enzyme which catalyzes the phosphorylation of fructosamines which may result in deglycation. [provided by RefSeq, Feb 2012]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.