Human MAP3K8/AURA2/c-COT ORF/cDNA clone-Lentivirus plasmid (NM_001320961.1)

Cat. No.: pGMLP005497
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human MAP3K8/AURA2/c-COT Lentiviral expression plasmid for MAP3K8 lentivirus packaging, MAP3K8 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to COT/MAP3K8/AURA2 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $693.12
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP005497
Gene Name MAP3K8
Accession Number NM_001320961.1
Gene ID 1326
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1404 bp
Gene Alias AURA2,c-COT,COT,EST,ESTF,MEKK8,Tpl-2,TPL2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGAGTACATGAGCACTGGAAGTGACAATAAAGAAGAGATTGATTTATTAATTAAACATTTAAATGTGTCTGATGTAATAGACATTATGGAAAATCTTTATGCAAGTGAAGAGCCAGCAGTTTATGAACCCAGTCTAATGACCATGTGTCAAGACAGTAATCAAAACGATGAGCGTTCTAAGTCTCTGCTGCTTAGTGGCCAAGAGGTACCATGGTTGTCATCAGTCAGATATGGAACTGTGGAGGATTTGCTTGCTTTTGCAAACCATATATCCAACACTGCAAAGCATTTTTATGGACAACGACCACAGGAATCTGGAATTTTATTAAACATGGTCATCACTCCCCAAAATGGACGTTACCAAATAGATTCCGATGTTCTCCTGATCCCCTGGAAGCTGACTTACAGGAATATTGGTTCTGATTTTATTCCTCGGGGCGCCTTTGGAAAGGTATACTTGGCACAAGATATAAAGACGAAGAAAAGAATGGCGTGTAAACTGATCCCAGTAGATCAATTTAAGCCATCTGATGTGGAAATCCAGGCTTGCTTCCGGCACGAGAACATCGCAGAGCTGTATGGCGCAGTCCTGTGGGGTGAAACTGTCCATCTCTTTATGGAAGCAGGCGAGGGAGGGTCTGTTCTGGAGAAACTGGAGAGCTGTGGACCAATGAGAGAATTTGAAATTATTTGGGTGACAAAGCATGTTCTCAAGGGACTTGATTTTCTACACTCAAAGAAAGTGATCCATCATGATATTAAACCTAGCAACATTGTTTTCATGTCCACAAAAGCTGTTTTGGTGGATTTTGGCCTAAGTGTTCAAATGACCGAAGATGTCTATTTTCCTAAGGACCTCCGAGGAACAGAGATTTACATGAGCCCAGAGGTCATCCTGTGCAGGGGCCATTCAACCAAAGCAGACATCTACAGCCTGGGGGCCACGCTCATCCACATGCAGACGGGCACCCCACCCTGGGTGAAGCGCTACCCTCGCTCAGCCTATCCCTCCTACCTGTACATAATCCACAAGCAAGCACCTCCACTGGAAGACATTGCAGATGACTGCAGTCCAGGGATGAGAGAGCTGATAGAAGCTTCCCTGGAGAGAAACCCCAATCACCGCCCAAGAGCCGCAGACCTACTAAAACATGAGGCCCTGAACCCGCCCAGAGAGGATCAGCCACGCTGTCAGAGTCTGGACTCTGCCCTCTTGGAGCGCAAGAGGCTGCTGAGTAGGAAGGAGCTGGAACTTCCTGAGAACATTGCTGATTCTTCGTGCACAGGAAGCACCGAGGAATCTGAGATGCTCAAGAGGCAACGCTCTCTCTACATCGACCTCGGCGCTCTGGCTGGCTACTTCAATCTTGTTCGGGGACCACCAACGCTTGAATATGGCTGA
ORF Protein Sequence MEYMSTGSDNKEEIDLLIKHLNVSDVIDIMENLYASEEPAVYEPSLMTMCQDSNQNDERSKSLLLSGQEVPWLSSVRYGTVEDLLAFANHISNTAKHFYGQRPQESGILLNMVITPQNGRYQIDSDVLLIPWKLTYRNIGSDFIPRGAFGKVYLAQDIKTKKRMACKLIPVDQFKPSDVEIQACFRHENIAELYGAVLWGETVHLFMEAGEGGSVLEKLESCGPMREFEIIWVTKHVLKGLDFLHSKKVIHHDIKPSNIVFMSTKAVLVDFGLSVQMTEDVYFPKDLRGTEIYMSPEVILCRGHSTKADIYSLGATLIHMQTGTPPWVKRYPRSAYPSYLYIIHKQAPPLEDIADDCSPGMRELIEASLERNPNHRPRAADLLKHEALNPPREDQPRCQSLDSALLERKRLLSRKELELPENIADSSCTGSTEESEMLKRQRSLYIDLGALAGYFNLVRGPPTLEYG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T00852-Ab Anti-COT monoclonal antibody
    Target Antigen GM-Tg-g-T00852-Ag COT/MAP3K8 protein
    ORF Viral Vector pGMLP005497 Human MAP3K8 Lentivirus plasmid
    ORF Viral Vector vGMLP005497 Human MAP3K8 Lentivirus particle


    Target information

    Target ID GM-T00852
    Target Name COT
    Gene ID 1326, 26410, 696936, 116596, 101090624, 487085, 535622, 100063602
    Gene Symbol and Synonyms AURA2,c-COT,COT,Cot/Tpl2,D17TPL2,EST,ESTF,MAP3K8,MEKK8,Tpl-2,TPL2
    Uniprot Accession P41279
    Uniprot Entry Name M3K8_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000107968
    Target Classification Tumor-associated antigen (TAA)

    This gene is an oncogene that encodes a member of the serine/threonine protein kinase family. The encoded protein localizes to the cytoplasm and can activate both the MAP kinase and JNK kinase pathways. This protein was shown to activate IkappaB kinases, and thus induce the nuclear production of NF-kappaB. This protein was also found to promote the production of TNF-alpha and IL-2 during T lymphocyte activation. This gene may also utilize a downstream in-frame translation start codon, and thus produce an isoform containing a shorter N-terminus. The shorter isoform has been shown to display weaker transforming activity. Alternate splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Sep 2011]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.