Human WNT2B/WNT13 ORF/cDNA clone-Lentivirus plasmid (NM_024494.2)

Cat. No.: pGMLP005568
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human WNT2B/WNT13 Lentiviral expression plasmid for WNT2B lentivirus packaging, WNT2B lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to WNT2B/WNT13 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $629.28
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP005568
Gene Name WNT2B
Accession Number NM_024494.2
Gene ID 7482
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1176 bp
Gene Alias WNT13
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCTGAGACCGGGTGGTGCGGAGGAAGCTGCGCAGCTCCCGCTTCGGCGCGCCAGCGCCCCGGTCCCTGTGCCGTCGCCCGCGGCCCCCGACGGCTCCCGGGCTTCGGCCCGCCTAGGTCTTGCCTGCCTTCTGCTCCTGCTGCTGCTGACGCTGCCGGCCCGCGTAGACACGTCCTGGTGGTACATTGGGGCACTGGGGGCACGAGTGATCTGTGACAATATCCCTGGTTTGGTGAGCCGGCAGCGGCAGCTGTGCCAGCGTTACCCAGACATCATGCGTTCAGTGGGCGAGGGTGCCCGAGAATGGATCCGAGAGTGTCAGCACCAATTCCGCCACCACCGCTGGAACTGTACCACCCTGGACCGGGACCACACCGTCTTTGGCCGTGTCATGCTCAGAAGTAGCCGAGAGGCAGCTTTTGTATATGCCATCTCATCAGCAGGGGTAGTCCACGCTATTACTCGCGCCTGTAGCCAGGGTGAACTGAGTGTGTGCAGCTGTGACCCCTACACCCGTGGCCGACACCATGACCAGCGTGGGGACTTTGACTGGGGTGGCTGCAGTGACAACATCCACTACGGTGTCCGTTTTGCCAAGGCCTTCGTGGATGCCAAGGAGAAGAGGCTTAAGGATGCCCGGGCCCTCATGAACTTACATAATAACCGCTGTGGTCGCACGGCTGTGCGGCGGTTTCTGAAGCTGGAGTGTAAGTGCCATGGCGTGAGTGGTTCCTGTACTCTGCGCACCTGCTGGCGTGCACTCTCAGATTTCCGCCGCACAGGTGATTACCTGCGGCGACGCTATGATGGGGCTGTGCAGGTGATGGCCACCCAAGATGGTGCCAACTTCACCGCAGCCCGCCAAGGCTATCGCCGTGCCACCCGGACTGATCTTGTCTACTTTGACAACTCTCCAGATTACTGTGTCTTGGACAAGGCTGCAGGTTCCCTAGGCACTGCAGGCCGTGTCTGCAGCAAGACATCAAAAGGAACAGACGGTTGTGAAATCATGTGCTGTGGCCGAGGGTACGACACAACTCGAGTCACCCGTGTTACCCAGTGTGAGTGCAAATTCCACTGGTGCTGTGCTGTACGGTGCAAGGAATGCAGAAATACTGTGGACGTCCATACTTGCAAAGCCCCCAAGAAGGCAGAGTGGCTGGACCAAACCTGA
ORF Protein Sequence MLRPGGAEEAAQLPLRRASAPVPVPSPAAPDGSRASARLGLACLLLLLLLTLPARVDTSWWYIGALGARVICDNIPGLVSRQRQLCQRYPDIMRSVGEGAREWIRECQHQFRHHRWNCTTLDRDHTVFGRVMLRSSREAAFVYAISSAGVVHAITRACSQGELSVCSCDPYTRGRHHDQRGDFDWGGCSDNIHYGVRFAKAFVDAKEKRLKDARALMNLHNNRCGRTAVRRFLKLECKCHGVSGSCTLRTCWRALSDFRRTGDYLRRRYDGAVQVMATQDGANFTAARQGYRRATRTDLVYFDNSPDYCVLDKAAGSLGTAGRVCSKTSKGTDGCEIMCCGRGYDTTRVTRVTQCECKFHWCCAVRCKECRNTVDVHTCKAPKKAEWLDQT

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0558-Ab Anti-WNT2B/ WNT13 functional antibody
    Target Antigen GM-Tg-g-SE0558-Ag WNT2B protein
    Cytokine cks-Tg-g-GM-SE0558 wingless-type MMTV integration site family, member 2B (WNT2B) protein & antibody
    ORF Viral Vector pGMLP005568 Human WNT2B Lentivirus plasmid
    ORF Viral Vector vGMLP005568 Human WNT2B Lentivirus particle


    Target information

    Target ID GM-SE0558
    Target Name WNT2B
    Gene ID 7482, 22414, 705773, 116466, 101080904, 483220, 445420, 100063931
    Gene Symbol and Synonyms WNT13,WNT2B
    Uniprot Accession Q93097
    Uniprot Entry Name WNT2B_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Cytokine Target
    Disease Not Available
    Gene Ensembl ENSG00000134245
    Target Classification Not Available

    This gene encodes a member of the wingless-type MMTV integration site (WNT) family of highly conserved, secreted signaling factors. WNT family members function in a variety of developmental processes including regulation of cell growth and differentiation and are characterized by a WNT-core domain. This gene may play a role in human development as well as carcinogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.