Human WNT11/HWNT11 ORF/cDNA clone-Lentivirus plasmid (NM_004626.2)

Cat. No.: pGMLP005575
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human WNT11/HWNT11 Lentiviral expression plasmid for WNT11 lentivirus packaging, WNT11 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to WNT11/HWNT11 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $598.2
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP005575
Gene Name WNT11
Accession Number NM_004626.2
Gene ID 7481
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1065 bp
Gene Alias HWNT11
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAGGGCGCGGCCGCAGGTCTGCGAGGCGCTGCTCTTCGCCCTGGCGCTCCAGACCGGCGTGTGCTATGGCATCAAGTGGCTGGCGCTGTCCAAGACACCATCGGCCCTGGCACTGAACCAGACGCAACACTGCAAGCAGCTGGAGGGTCTGGTGTCTGCACAGGTGCAGCTGTGCCGCAGCAACCTGGAGCTCATGCACACGGTGGTGCACGCCGCCCGCGAGGTCATGAAGGCCTGTCGCCGGGCCTTTGCCGACATGCGCTGGAACTGCTCCTCCATTGAGCTCGCCCCCAACTATTTGCTTGACCTGGAGAGAGGGACCCGGGAGTCGGCCTTCGTGTATGCGCTGTCGGCCGCCGCCATCAGCCACGCCATCGCCCGGGCCTGCACCTCCGGCGACCTGCCCGGCTGCTCCTGCGGCCCCGTCCCAGGTGAGCCACCCGGGCCCGGGAACCGCTGGGGAGGATGTGCGGACAACCTCAGCTACGGGCTCCTCATGGGGGCCAAGTTTTCCGATGCTCCTATGAAGGTGAAAAAAACAGGATCCCAAGCCAATAAACTGATGCGTCTACACAACAGTGAAGTGGGGAGACAGGCTCTGCGCGCCTCTCTGGAAATGAAGTGTAAGTGCCATGGGGTGTCTGGCTCCTGCTCCATCCGCACCTGCTGGAAGGGGCTGCAGGAGCTGCAGGATGTGGCTGCTGACCTCAAGACCCGATACCTGTCGGCCACCAAGGTAGTGCACCGACCCATGGGCACCCGCAAGCACCTGGTGCCCAAGGACCTGGATATCCGGCCTGTGAAGGACTCGGAACTCGTCTATCTGCAGAGCTCACCTGACTTCTGCATGAAGAATGAGAAGGTGGGCTCCCACGGGACACAAGACAGGCAGTGCAACAAGACATCCAACGGAAGCGACAGCTGCGACCTTATGTGCTGCGGGCGTGGCTACAACCCCTACACAGACCGCGTGGTCGAGCGGTGCCACTGTAAGTACCACTGGTGCTGCTACGTCACCTGCCGCAGGTGTGAGCGTACCGTGGAGCGCTATGTCTGCAAGTGA
ORF Protein Sequence MRARPQVCEALLFALALQTGVCYGIKWLALSKTPSALALNQTQHCKQLEGLVSAQVQLCRSNLELMHTVVHAAREVMKACRRAFADMRWNCSSIELAPNYLLDLERGTRESAFVYALSAAAISHAIARACTSGDLPGCSCGPVPGEPPGPGNRWGGCADNLSYGLLMGAKFSDAPMKVKKTGSQANKLMRLHNSEVGRQALRASLEMKCKCHGVSGSCSIRTCWKGLQELQDVAADLKTRYLSATKVVHRPMGTRKHLVPKDLDIRPVKDSELVYLQSSPDFCMKNEKVGSHGTQDRQCNKTSNGSDSCDLMCCGRGYNPYTDRVVERCHCKYHWCCYVTCRRCERTVERYVCK

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0556-Ab Anti-WNT11/ HWNT11 functional antibody
    Target Antigen GM-Tg-g-SE0556-Ag WNT11 protein
    Cytokine cks-Tg-g-GM-SE0556 wingless-type MMTV integration site family, member 11 (WNT11) protein & antibody
    ORF Viral Vector pGMLP005575 Human WNT11 Lentivirus plasmid
    ORF Viral Vector vGMLP005575 Human WNT11 Lentivirus particle


    Target information

    Target ID GM-SE0556
    Target Name WNT11
    Gene ID 7481, 22411, 696845, 140584, 101100080, 485183, 613288, 100064184
    Gene Symbol and Synonyms HWNT11,WNT11
    Uniprot Accession O96014
    Uniprot Entry Name WNT11_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Cytokine Target
    Disease Not Available
    Gene Ensembl ENSG00000085741
    Target Classification Not Available

    The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It encodes a protein which shows 97%, 85%, and 63% amino acid identity with mouse, chicken, and Xenopus Wnt11 protein, respectively. This gene may play roles in the development of skeleton, kidney and lung, and is considered to be a plausible candidate gene for High Bone Mass Syndrome. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.