Human WNT11/HWNT11 ORF/cDNA clone-Lentivirus plasmid (NM_004626.2)
Cat. No.: pGMLP005575
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human WNT11/HWNT11 Lentiviral expression plasmid for WNT11 lentivirus packaging, WNT11 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
WNT11/HWNT11 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP005575 |
Gene Name | WNT11 |
Accession Number | NM_004626.2 |
Gene ID | 7481 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1065 bp |
Gene Alias | HWNT11 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGAGGGCGCGGCCGCAGGTCTGCGAGGCGCTGCTCTTCGCCCTGGCGCTCCAGACCGGCGTGTGCTATGGCATCAAGTGGCTGGCGCTGTCCAAGACACCATCGGCCCTGGCACTGAACCAGACGCAACACTGCAAGCAGCTGGAGGGTCTGGTGTCTGCACAGGTGCAGCTGTGCCGCAGCAACCTGGAGCTCATGCACACGGTGGTGCACGCCGCCCGCGAGGTCATGAAGGCCTGTCGCCGGGCCTTTGCCGACATGCGCTGGAACTGCTCCTCCATTGAGCTCGCCCCCAACTATTTGCTTGACCTGGAGAGAGGGACCCGGGAGTCGGCCTTCGTGTATGCGCTGTCGGCCGCCGCCATCAGCCACGCCATCGCCCGGGCCTGCACCTCCGGCGACCTGCCCGGCTGCTCCTGCGGCCCCGTCCCAGGTGAGCCACCCGGGCCCGGGAACCGCTGGGGAGGATGTGCGGACAACCTCAGCTACGGGCTCCTCATGGGGGCCAAGTTTTCCGATGCTCCTATGAAGGTGAAAAAAACAGGATCCCAAGCCAATAAACTGATGCGTCTACACAACAGTGAAGTGGGGAGACAGGCTCTGCGCGCCTCTCTGGAAATGAAGTGTAAGTGCCATGGGGTGTCTGGCTCCTGCTCCATCCGCACCTGCTGGAAGGGGCTGCAGGAGCTGCAGGATGTGGCTGCTGACCTCAAGACCCGATACCTGTCGGCCACCAAGGTAGTGCACCGACCCATGGGCACCCGCAAGCACCTGGTGCCCAAGGACCTGGATATCCGGCCTGTGAAGGACTCGGAACTCGTCTATCTGCAGAGCTCACCTGACTTCTGCATGAAGAATGAGAAGGTGGGCTCCCACGGGACACAAGACAGGCAGTGCAACAAGACATCCAACGGAAGCGACAGCTGCGACCTTATGTGCTGCGGGCGTGGCTACAACCCCTACACAGACCGCGTGGTCGAGCGGTGCCACTGTAAGTACCACTGGTGCTGCTACGTCACCTGCCGCAGGTGTGAGCGTACCGTGGAGCGCTATGTCTGCAAGTGA |
ORF Protein Sequence | MRARPQVCEALLFALALQTGVCYGIKWLALSKTPSALALNQTQHCKQLEGLVSAQVQLCRSNLELMHTVVHAAREVMKACRRAFADMRWNCSSIELAPNYLLDLERGTRESAFVYALSAAAISHAIARACTSGDLPGCSCGPVPGEPPGPGNRWGGCADNLSYGLLMGAKFSDAPMKVKKTGSQANKLMRLHNSEVGRQALRASLEMKCKCHGVSGSCSIRTCWKGLQELQDVAADLKTRYLSATKVVHRPMGTRKHLVPKDLDIRPVKDSELVYLQSSPDFCMKNEKVGSHGTQDRQCNKTSNGSDSCDLMCCGRGYNPYTDRVVERCHCKYHWCCYVTCRRCERTVERYVCK |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE0556-Ab | Anti-WNT11/ HWNT11 functional antibody |
Target Antigen | GM-Tg-g-SE0556-Ag | WNT11 protein |
Cytokine | cks-Tg-g-GM-SE0556 | wingless-type MMTV integration site family, member 11 (WNT11) protein & antibody |
ORF Viral Vector | pGMLP005575 | Human WNT11 Lentivirus plasmid |
ORF Viral Vector | vGMLP005575 | Human WNT11 Lentivirus particle |
Target information
Target ID | GM-SE0556 |
Target Name | WNT11 |
Gene ID | 7481, 22411, 696845, 140584, 101100080, 485183, 613288, 100064184 |
Gene Symbol and Synonyms | HWNT11,WNT11 |
Uniprot Accession | O96014 |
Uniprot Entry Name | WNT11_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Cytokine Target |
Disease | Not Available |
Gene Ensembl | ENSG00000085741 |
Target Classification | Not Available |
The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It encodes a protein which shows 97%, 85%, and 63% amino acid identity with mouse, chicken, and Xenopus Wnt11 protein, respectively. This gene may play roles in the development of skeleton, kidney and lung, and is considered to be a plausible candidate gene for High Bone Mass Syndrome. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.