Human FNTA/FPTA/PGGT1A ORF/cDNA clone-Lentivirus plasmid (NM_002027.2)

Cat. No.: pGMLP005641
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human FNTA/FPTA/PGGT1A Lentiviral expression plasmid for FNTA lentivirus packaging, FNTA lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to FNTA/FPTA products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $619.2
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP005641
Gene Name FNTA
Accession Number NM_002027.2
Gene ID 2339
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1140 bp
Gene Alias FPTA,PGGT1A,PTAR2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCGGCCACCGAGGGGGTCGGGGAGGCTGCGCAAGGGGGCGAGCCCGGGCAGCCGGCGCAACCCCCGCCCCAGCCGCACCCACCGCCGCCCCAGCAGCAGCACAAGGAAGAGATGGCGGCCGAGGCTGGGGAAGCCGTGGCGTCCCCCATGGACGACGGGTTTGTGAGCCTGGACTCGCCCTCCTATGTCCTGTACAGGGACAGAGCAGAATGGGCTGATATAGATCCGGTGCCGCAGAATGATGGCCCCAATCCCGTGGTCCAGATCATTTATAGTGACAAATTTAGAGATGTTTATGATTACTTCCGAGCTGTCCTGCAGCGTGATGAAAGAAGTGAACGAGCTTTTAAGCTAACCCGGGATGCTATTGAGTTAAATGCAGCCAATTATACAGTGTGGCATTTCCGGAGAGTTCTTTTGAAGTCACTTCAGAAGGATCTACATGAGGAAATGAACTACATCACTGCAATAATTGAGGAGCAGCCCAAAAACTATCAAGTTTGGCATCATAGGCGAGTATTAGTGGAATGGCTAAGAGATCCATCTCAGGAGCTTGAATTTATTGCTGATATTCTTAATCAGGATGCAAAGAATTATCATGCCTGGCAGCATCGACAATGGGTTATTCAGGAATTTAAACTTTGGGATAATGAGCTGCAGTATGTGGACCAACTTCTGAAAGAGGATGTGAGAAATAACTCTGTCTGGAACCAAAGATACTTCGTTATTTCTAACACCACTGGCTACAATGATCGTGCTGTATTGGAGAGAGAAGTCCAATACACTCTGGAAATGATTAAACTAGTACCACATAATGAAAGTGCATGGAACTATTTGAAAGGGATTTTGCAGGATCGTGGTCTTTCCAAATATCCTAATCTGTTAAATCAATTACTTGATTTACAACCAAGTCATAGTTCCCCCTACCTAATTGCCTTTCTTGTGGATATCTATGAAGACATGCTAGAAAATCAGTGTGACAATAAGGAAGACATTCTTAATAAAGCATTAGAGTTATGTGAAATCCTAGCTAAAGAAAAGGACACTATAAGAAAGGAATATTGGAGATACATTGGAAGATCCCTTCAAAGCAAACACAGCACAGAAAATGACTCACCAACAAATGTACAGCAATAA
ORF Protein Sequence MAATEGVGEAAQGGEPGQPAQPPPQPHPPPPQQQHKEEMAAEAGEAVASPMDDGFVSLDSPSYVLYRDRAEWADIDPVPQNDGPNPVVQIIYSDKFRDVYDYFRAVLQRDERSERAFKLTRDAIELNAANYTVWHFRRVLLKSLQKDLHEEMNYITAIIEEQPKNYQVWHHRRVLVEWLRDPSQELEFIADILNQDAKNYHAWQHRQWVIQEFKLWDNELQYVDQLLKEDVRNNSVWNQRYFVISNTTGYNDRAVLEREVQYTLEMIKLVPHNESAWNYLKGILQDRGLSKYPNLLNQLLDLQPSHSSPYLIAFLVDIYEDMLENQCDNKEDILNKALELCEILAKEKDTIRKEYWRYIGRSLQSKHSTENDSPTNVQQ

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-TA096-Ab Anti-FNTA monoclonal antibody
    Target Antigen GM-Tg-g-TA096-Ag FNTA protein
    ORF Viral Vector pGMLP005641 Human FNTA Lentivirus plasmid
    ORF Viral Vector vGMLP005641 Human FNTA Lentivirus particle


    Target information

    Target ID GM-TA096
    Target Name FNTA
    Gene ID 2339, 14272, 712681, 25318, 101097062, 475566, 281169, 100053704
    Gene Symbol and Synonyms FNTA,FPTA,FTA,PFAS,PGGT1A,PTAR2
    Uniprot Accession P49354
    Uniprot Entry Name FNTA_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000168522
    Target Classification Not Available

    Prenyltransferases can attach either a farnesyl group or a geranylgeranyl group in thioether linkage to the cysteine residue of proteins with a C-terminal CAAX box. CAAX geranylgeranyltransferase and CAAX farnesyltransferase are heterodimers that share the same alpha subunit but have different beta subunits. This gene encodes the alpha subunit of these transferases. Alternative splicing results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 11 and 13. [provided by RefSeq, May 2010]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.